ID: 1000342274

View in Genome Browser
Species Human (GRCh38)
Location 5:160287035-160287057
Sequence CAAGCTAATCCCCGGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000342274_1000342277 -4 Left 1000342274 5:160287035-160287057 CCCACATACCGGGGATTAGCTTG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1000342277 5:160287054-160287076 CTTGATACCTACAGAGTGTGAGG No data
1000342274_1000342281 11 Left 1000342274 5:160287035-160287057 CCCACATACCGGGGATTAGCTTG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1000342281 5:160287069-160287091 GTGTGAGGTCAGGCAGTTCTGGG 0: 1
1: 0
2: 3
3: 21
4: 240
1000342274_1000342278 1 Left 1000342274 5:160287035-160287057 CCCACATACCGGGGATTAGCTTG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1000342278 5:160287059-160287081 TACCTACAGAGTGTGAGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 111
1000342274_1000342280 10 Left 1000342274 5:160287035-160287057 CCCACATACCGGGGATTAGCTTG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1000342280 5:160287068-160287090 AGTGTGAGGTCAGGCAGTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 203
1000342274_1000342282 15 Left 1000342274 5:160287035-160287057 CCCACATACCGGGGATTAGCTTG 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1000342282 5:160287073-160287095 GAGGTCAGGCAGTTCTGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000342274 Original CRISPR CAAGCTAATCCCCGGTATGT GGG (reversed) Intronic
900465298 1:2822384-2822406 CAAGCCCAAGCCCGGTATGTGGG - Intergenic
908155493 1:61348545-61348567 CAAGCTAAGCCCGTTTATGTGGG + Intronic
911190682 1:94945540-94945562 AAATCTAATCCCCAGTATGGTGG + Intergenic
915954202 1:160209269-160209291 GATGCTAATCCCCGGGTTGTGGG - Intronic
917639038 1:176964573-176964595 CGTGCTATTCCCAGGTATGTAGG + Intronic
922987360 1:229876210-229876232 AAAGTTAATCACAGGTATGTAGG - Intergenic
1067534708 10:47100527-47100549 AAATCTAATCCCCAGTGTGTTGG + Intergenic
1072048678 10:91682109-91682131 CTAGCTAAAGCCTGGTATGTAGG - Intergenic
1080133582 11:28826130-28826152 CAACCTAATCCCCAGTGTGATGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1093580752 12:20782200-20782222 CCAGGTAGTCCCCGGTATGACGG + Intergenic
1097266792 12:57750625-57750647 CAAGGTAGTCCAGGGTATGTGGG + Intronic
1109384602 13:61610132-61610154 CATGCTAATCCCTGGAATCTTGG - Intergenic
1120472635 14:84945859-84945881 TAAGCTAATGTCAGGTATGTCGG + Intergenic
1123726840 15:23111779-23111801 AAAGCTGATTCACGGTATGTAGG - Intergenic
1131636192 15:94235329-94235351 CAAGTTAATCTCAGGTACGTAGG - Intronic
1132063506 15:98712044-98712066 AAACCTAATCCCCAGTATGATGG - Intronic
1132353737 15:101156361-101156383 CAAGAAATTCCCCGGTTTGTTGG - Intergenic
1133549326 16:6838687-6838709 CATGCTAATCCCCAGTCTGGGGG + Intronic
1165059608 19:33198667-33198689 CATCCTAAGCCCAGGTATGTTGG + Intronic
1166777503 19:45322018-45322040 CAAGCCGAGCCCCGGAATGTGGG - Intronic
940365992 2:152849659-152849681 CCAGCTAATCCCAGCTATTTGGG - Intergenic
943473043 2:188318948-188318970 CAAGCTAAGCCCCAGTTTGGGGG + Intronic
1173680625 20:44878119-44878141 CAAGTTAATTGCTGGTATGTAGG - Intergenic
1181463998 22:23101132-23101154 CAATCTAAGCCCTGGTATGCTGG - Intronic
1181690880 22:24559597-24559619 CAAGCTGATTCCAGGTCTGTCGG - Intronic
1184658531 22:45954544-45954566 CACGCTTATCCGGGGTATGTGGG + Intronic
951374945 3:21902427-21902449 CAAGGTGATCACCGGTATCTTGG + Intronic
951577797 3:24131570-24131592 CAACCTAATCCCCAGTGTGATGG + Intronic
951656766 3:25017832-25017854 AAAGCTAATCCCCAGTGTGATGG + Intergenic
967269792 3:187724088-187724110 CAGGTTAACCTCCGGTATGTAGG + Intronic
978232673 4:106419542-106419564 AAACCTAATCCCCGGTGTGATGG + Intergenic
981301591 4:143192727-143192749 AAATCTAATCCCCAGTGTGTTGG - Intronic
1000342274 5:160287035-160287057 CAAGCTAATCCCCGGTATGTGGG - Intronic
1002065572 5:176650105-176650127 CCAGCGAATCCCCGGCATGGCGG + Intronic
1008346823 6:50437809-50437831 AAAGCTAATCCCCAGTATGATGG + Intergenic
1013309977 6:108884708-108884730 AATGCTACTCCCAGGTATGTGGG + Intronic
1015384584 6:132607293-132607315 CAACATAATCCCAGGTATGAGGG + Intergenic
1020402309 7:7792988-7793010 AAACCTAATCCCCAGTGTGTTGG - Intronic
1026076775 7:67178960-67178982 CAAGCTAAGCCCCGGTTTTGGGG - Intronic
1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG + Intronic
1042584623 8:70321989-70322011 CATGGTAATCCCAGGTACGTGGG + Intronic
1051014737 9:12461044-12461066 AAAGTTAATCCCCGGTATGCTGG - Intergenic
1053031675 9:34785370-34785392 CAACTTAATCCCCGTTATGGTGG - Intergenic
1059553116 9:115250449-115250471 AAAGCTAATCCCCAGTGTGATGG + Intronic
1203612601 Un_KI270749v1:23252-23274 AAATCTAATTCCCAGTATGTTGG + Intergenic
1189736120 X:44071704-44071726 CAAGCTAATCTCCAGTACCTTGG + Intergenic
1194163506 X:90484709-90484731 AAATCTAATCCCCGGTATGATGG - Intergenic
1200509773 Y:4062437-4062459 AAATCTAATCCCCGGTATGATGG - Intergenic