ID: 1000343919

View in Genome Browser
Species Human (GRCh38)
Location 5:160298511-160298533
Sequence AGGCCCAGGGGAGCAGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 1, 2: 6, 3: 55, 4: 589}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000343919_1000343930 26 Left 1000343919 5:160298511-160298533 CCAGCGCCTGCTCCCCTGGGCCT 0: 1
1: 1
2: 6
3: 55
4: 589
Right 1000343930 5:160298560-160298582 CAACAAATAATTGCAGAAATAGG 0: 1
1: 0
2: 1
3: 50
4: 503
1000343919_1000343927 -9 Left 1000343919 5:160298511-160298533 CCAGCGCCTGCTCCCCTGGGCCT 0: 1
1: 1
2: 6
3: 55
4: 589
Right 1000343927 5:160298525-160298547 CCTGGGCCTACAGTCTGGGGAGG 0: 1
1: 0
2: 0
3: 30
4: 229
1000343919_1000343928 -8 Left 1000343919 5:160298511-160298533 CCAGCGCCTGCTCCCCTGGGCCT 0: 1
1: 1
2: 6
3: 55
4: 589
Right 1000343928 5:160298526-160298548 CTGGGCCTACAGTCTGGGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000343919 Original CRISPR AGGCCCAGGGGAGCAGGCGC TGG (reversed) Intronic
900117071 1:1033462-1033484 AGCGCCTGGGGAGCAGGAGCTGG - Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900227652 1:1540489-1540511 CGGCCGGGGGGAGGAGGCGCGGG + Intergenic
900324330 1:2100621-2100643 GGGCCTCGGGGAGCAGGTGCAGG + Intronic
900481344 1:2900924-2900946 GGGCCCAGAGCAGCAGGCACAGG - Intergenic
900525422 1:3126186-3126208 AAGCCCAGGGGAGCTGGGCCGGG - Intronic
900534611 1:3170690-3170712 GGGCCCGGGGGAGCAGGGGAAGG + Intronic
900678582 1:3903701-3903723 AGGGGCAGGGGAACAGGTGCTGG - Intergenic
900707674 1:4090576-4090598 AGGCTCAGGGCAGCAGCAGCTGG - Intergenic
901402901 1:9026418-9026440 AGGCCCAGGGGAGAAACAGCCGG - Intergenic
901836287 1:11926078-11926100 GGGACCAGGGCAGCAGGTGCAGG + Exonic
902893931 1:19465746-19465768 AGGCCCAGGACAGGAGGCACTGG - Intronic
902924604 1:19687913-19687935 AGACCCAGGGGAGCAGTTGCTGG + Intronic
903082257 1:20820223-20820245 AGGCCCAGGTCTGCAGCCGCAGG - Intronic
903192445 1:21664263-21664285 AGGCCCAGGGAAACAGGCGAGGG + Intronic
903284401 1:22267956-22267978 TGGCCCAGGGCAGCAGGGTCTGG + Intergenic
903337836 1:22636744-22636766 GGACCCAGGGGAGCTGGCCCAGG + Intronic
903746472 1:25590189-25590211 AGGCCCAGGGCTGCATGCCCAGG + Intergenic
903860573 1:26361956-26361978 GGGCCCCGGAGTGCAGGCGCAGG + Exonic
904586586 1:31584199-31584221 AGGCCCAGGGGAATAAGGGCAGG - Intronic
904847347 1:33430510-33430532 GGGACAAGCGGAGCAGGCGCAGG + Intronic
905171753 1:36113874-36113896 AGGCCCACGGGGGCAGGTGATGG + Intronic
905459733 1:38114727-38114749 AGGCACTGGGGAGGAGGTGCTGG + Intergenic
905664306 1:39753285-39753307 AGGCCCAGGGCAGCAAGGACGGG + Intronic
906155003 1:43608922-43608944 ATGCCCAGGGCAGCAGGGGAGGG - Intronic
907120027 1:52000244-52000266 AGGGCCAGGGAAGCAGACACAGG - Intergenic
908253430 1:62283227-62283249 AGGGAGAGGGGAGCAGGAGCAGG - Intronic
912420388 1:109538739-109538761 AGTCTCAGGGAAGCAGGCTCTGG + Intergenic
912472265 1:109913794-109913816 GGGCCCAGGGGAGCTGTCTCTGG + Intronic
912552233 1:110491743-110491765 AGGCTCAGGGGCTCAGGCCCTGG + Intergenic
912697017 1:111849360-111849382 AAGCCCAGGGGATCTGGCTCAGG + Intronic
912955824 1:114153609-114153631 AGTCCCAGCGCGGCAGGCGCAGG - Intronic
915299458 1:154943849-154943871 CTGGCCAGTGGAGCAGGCGCTGG + Intergenic
915448535 1:155989036-155989058 AGACCCAGGGGAGCAGACAGAGG + Intronic
915476109 1:156153812-156153834 AGGCCCAGGGAGGCAGACACAGG + Intronic
915507921 1:156369095-156369117 GGGCCCCGGGGACCAGGAGCGGG - Intergenic
915935816 1:160089771-160089793 AGGCCCAGGAGAGCCTGCCCTGG + Exonic
916326037 1:163561151-163561173 AGGCCCAGAGGAGCAAGCATAGG + Intergenic
919674297 1:200366337-200366359 GGGCCCAGGGCAGCATGTGCTGG + Intergenic
919812491 1:201417856-201417878 AGGCCCAGCTGGGCAGGGGCAGG - Intronic
920053957 1:203179596-203179618 AGGCCCAGAGGAGCAGGGCTGGG + Intronic
920121956 1:203665401-203665423 AGGCACAGGCTAGCAGGCGTGGG + Intronic
920192699 1:204203646-204203668 AGGACAATGGGAGCAGGTGCAGG - Intronic
920961784 1:210670229-210670251 TGGCCCAGGGGGGCAGGGGTAGG - Intronic
921089561 1:211830413-211830435 AGGCCCCGGGGAGGAGGCGGGGG - Intronic
921157203 1:212447807-212447829 AACCCCAGGGGAGGAGGCACAGG + Intergenic
921389623 1:214605600-214605622 AGCCCCTGGGGGGCCGGCGCGGG + Intronic
922235678 1:223720943-223720965 AGGCTCAGGGTAGAAAGCGCAGG - Intronic
922542437 1:226429391-226429413 AGGCCCAGGCAGGCAGCCGCCGG + Intergenic
922696555 1:227733826-227733848 AGGCCCAGGGTGGCAGGAGGGGG - Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
923892778 1:238234622-238234644 AGACACAGGTGAGCAGGTGCAGG + Intergenic
1062903795 10:1166260-1166282 AGGACCAGGGGAGCAGCGGGAGG + Intergenic
1063703688 10:8410319-8410341 AGGCCCAAGGGAGGAGGAGAGGG + Intergenic
1064255859 10:13742304-13742326 AATCCCAGGGAAGCAGGTGCAGG + Intronic
1067018304 10:42773693-42773715 AGGCTCAGGGGGGCAGCCACTGG - Intergenic
1067047541 10:42992971-42992993 AGGCCTGGGGGTGCTGGCGCAGG - Intergenic
1067102404 10:43342832-43342854 GGGCCCAGCGCAGCAGGCACTGG - Intergenic
1067224546 10:44367119-44367141 AGGCCCTGGGCAGCAGCCTCTGG - Intergenic
1067561695 10:47309011-47309033 AGCCCCAGGGAAGCCGGAGCTGG + Intronic
1069535554 10:69250178-69250200 AGGCCCAGGAGTGCAGGCCCTGG + Intronic
1070131117 10:73656018-73656040 AGGCCTGGGGCAGCAGGAGCAGG - Exonic
1070605914 10:77898476-77898498 AGGCACATGGGAGCAGGGGCTGG + Intronic
1071977026 10:90965279-90965301 AAGGCCAGGGGTGGAGGCGCTGG + Intergenic
1072247583 10:93556905-93556927 AGCCCCAGTGGAGCAGACTCAGG - Intergenic
1073072812 10:100805602-100805624 AGACTCAGGGGAGCAGGCACCGG + Intronic
1073436238 10:103517889-103517911 AGGCCCACGGGAGCAGAGCCAGG - Intronic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1075504506 10:123009673-123009695 CCGCCCAGGGGAGCCGGAGCCGG + Intronic
1075802535 10:125161538-125161560 AGGCCCGCGGGGTCAGGCGCGGG + Intergenic
1075874245 10:125793380-125793402 AGGCCCAGGGGAGAGGCAGCAGG + Intronic
1075999887 10:126905840-126905862 AGGTCCAGAGGAGCGGGCGTCGG - Intronic
1076319927 10:129570397-129570419 AGGCCCAGGTGGGCTGGCCCCGG - Intronic
1076449511 10:130547047-130547069 AGGCCTAGGGGAGCAGCTCCAGG - Intergenic
1076670555 10:132118509-132118531 AGGCCCCGGGAAGCAGGCAGAGG - Intronic
1076695519 10:132245584-132245606 AGGTCCTGAGGAGCAGCCGCAGG + Intronic
1076754858 10:132564100-132564122 AAGCCCAGGGGAGCAGCAGCAGG - Intronic
1076994847 11:292868-292890 AGGTCCTGGGGAGCAGGAGGAGG - Exonic
1077144786 11:1040031-1040053 GGGCCCAGCGGGGCAGGGGCAGG - Intergenic
1077219313 11:1408390-1408412 AGCCCCAGGGCAGCAGCCACGGG + Intronic
1077269262 11:1667403-1667425 AGGTCCAGGGCTGCAGGAGCAGG - Intergenic
1077271283 11:1683302-1683324 AGGTCCAGGGCTGCAGGAGCAGG + Intergenic
1077321075 11:1942238-1942260 AGGACCAGGACAGCAGGCGGGGG - Intergenic
1077344182 11:2038841-2038863 AGGCCCAGGAGAGGAAGAGCAGG - Intergenic
1077393983 11:2312259-2312281 AGGCCCAGCGGAGTGGGCCCGGG - Intronic
1077500356 11:2907204-2907226 AGGTCCAGGGGAGGGGGCGGGGG + Intronic
1077631778 11:3816158-3816180 AGGCCCTGAGGAGCAGGGGGTGG + Intronic
1077917310 11:6619609-6619631 ATTCCCAGGGGACCAGGCTCAGG - Intergenic
1078860146 11:15239214-15239236 AGGCTCAGGGGTGCAGCCGCTGG + Intronic
1078891389 11:15561250-15561272 AGGCACCGGGGAGCAGGGGGCGG - Intergenic
1079363735 11:19791435-19791457 AGCCCCTGGGGAGCACACGCTGG + Intronic
1080540650 11:33261231-33261253 AGGTTCAGGGGAGCATGTGCAGG + Intronic
1081850838 11:46274183-46274205 AGGGCCTGGGGAGCAGGGGTAGG - Intergenic
1082004920 11:47414158-47414180 GTGCCCAGGGGAGCAGGCCCAGG - Intronic
1082008962 11:47437826-47437848 GGGCCCAGGGGAGCAGCCCTGGG + Exonic
1082777525 11:57258869-57258891 AGGCTCAGGGATACAGGCGCAGG - Intergenic
1083006943 11:59355662-59355684 AGGCCCAGTGGAGCAGTCACAGG - Intergenic
1083609197 11:63997148-63997170 AGCCCGAGGTGAGCAGCCGCAGG - Exonic
1083774521 11:64887977-64887999 AGGCCTGGGGGAGCAGCCCCTGG - Intronic
1083945638 11:65921182-65921204 AGGCCCAGGGCAGCTCACGCAGG - Intronic
1084053693 11:66617348-66617370 AGGCCCAGGAGACCAGGAGAAGG - Intronic
1084502906 11:69545454-69545476 AGGCTCAGGAGAGGAGGGGCTGG - Intergenic
1085016559 11:73177755-73177777 AGGCTCAGGGAAGTAGGCACAGG + Intergenic
1085119512 11:73958098-73958120 ATGCCCAGGGGGGCAGCTGCTGG + Intronic
1085529521 11:77183236-77183258 GGGCCCACGGAAGCAGGAGCAGG + Intronic
1087127307 11:94640695-94640717 AGGCTCAGAGGGGCAGGGGCGGG - Intergenic
1088708201 11:112482606-112482628 AGGACCAGGGGAACAGGTGATGG + Intergenic
1088829570 11:113523894-113523916 AGGCCAAGGCGGGCAGGAGCTGG - Intergenic
1089701787 11:120249076-120249098 ATGCCCAGGGGAGCATTCTCAGG + Intronic
1090386906 11:126362635-126362657 TGGCCCAGGGGAAGAGGGGCAGG + Intronic
1091203390 11:133800272-133800294 AATCCTAGGGGAGCAGGAGCAGG + Intergenic
1091221966 11:133935126-133935148 ACGCCAGAGGGAGCAGGCGCAGG + Intronic
1091304255 11:134527447-134527469 AGTCCCAGACGAGCAGGCCCAGG + Intergenic
1202827168 11_KI270721v1_random:94030-94052 AGGCCCAGGAGAGGAAGAGCAGG - Intergenic
1091787000 12:3249098-3249120 AGGCCCTGGGAAGCAGACTCTGG - Intronic
1091985665 12:4909037-4909059 AGGCGCATGGCAGCAGGAGCCGG - Intergenic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1092597295 12:10021484-10021506 AGGCCCAGAGGCGAAGGTGCTGG + Intergenic
1096836107 12:54352324-54352346 AGGGGGAGGGGAGCAGGCTCTGG - Intergenic
1097107777 12:56635368-56635390 AGGCCTAGGGGTGCAGGAGAGGG + Intronic
1101838802 12:108313142-108313164 AGGCACAGGGAAGGAGGGGCAGG + Intronic
1102036163 12:109771595-109771617 AGCCCCTGGGGAGCAGGAGCCGG + Intergenic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1103225656 12:119285165-119285187 AGGCCCAAGGGAGCAGAGGGAGG - Intergenic
1103536792 12:121638911-121638933 AGGCCCAGGTGAGGAGCAGCGGG + Intronic
1103626654 12:122225555-122225577 GGGGCCGGGGGAGCTGGCGCAGG - Intronic
1103698537 12:122835636-122835658 AGACCCAGGCGAGCGGGCGGCGG + Exonic
1103954312 12:124567755-124567777 AGGGCCTGGAGAGAAGGCGCGGG - Intergenic
1104289626 12:127455784-127455806 AGGCAGAGGGGACCAGGAGCGGG + Intergenic
1104639341 12:130457489-130457511 AGTCCCAGGGGAGCAGGGAGCGG - Intronic
1104898587 12:132176022-132176044 AGGGCGAGGTGAGCAGGCTCTGG - Intergenic
1104973820 12:132543183-132543205 AGGCTCAGGACAGCAGCCGCTGG - Intronic
1105004981 12:132716006-132716028 AGGTCCAGGTGAGCAGCCGAGGG - Intronic
1105281038 13:18962764-18962786 AGGCACAGGCGGGCAGGAGCTGG - Intergenic
1105290240 13:19048776-19048798 AGGCACAGGCGGGCAGGAGCTGG - Intergenic
1105426337 13:20298141-20298163 TGGCCAAGGGGAGAAGGCGAAGG - Intergenic
1106183436 13:27387413-27387435 AGGCGCTGGGGAGGAGGCGAGGG + Intergenic
1106357028 13:28992665-28992687 GGGCCCAGGGGAGCATGCGAGGG - Intronic
1107586139 13:41850359-41850381 AGGCCCAGCCCAGCAGGCCCTGG + Intronic
1111288603 13:86130541-86130563 AGGCAAAAGGGAGCATGCGCAGG - Intergenic
1111841348 13:93454777-93454799 GGGCCGAGGAGTGCAGGCGCAGG - Intronic
1112833792 13:103488110-103488132 CGGCCCAGAGGAGCAGGGGTAGG - Intergenic
1113088360 13:106591919-106591941 AGGCCCAGGGGAAAAGGCAGAGG - Intergenic
1113665869 13:112141983-112142005 AGGCCCAGGGGAGCCGTGGCTGG - Intergenic
1113887905 13:113670672-113670694 AGGCGGAGGGGAGGGGGCGCTGG + Intronic
1113887921 13:113670718-113670740 AGGCGGAGGGGAGGGGGCGCTGG + Intronic
1113887937 13:113670763-113670785 AGGCGGAGGGGAGGGGGCGCTGG + Intronic
1113895103 13:113759279-113759301 AGGCCCAGGGGCCCGGGCACCGG - Exonic
1114267327 14:21080677-21080699 GGGCCCAGGGGAGGAGCAGCTGG + Exonic
1114267344 14:21080775-21080797 AGGTCCAGGTGAGAAGGGGCTGG + Exonic
1114865991 14:26597130-26597152 AGGTGCAGGGGAGGGGGCGCGGG + Intronic
1115127222 14:30010508-30010530 AGCCCTTGGGGAGCAGGGGCAGG + Intronic
1115149738 14:30270705-30270727 AGGCTGAGGGGAGCTGGGGCGGG - Intergenic
1115770148 14:36658895-36658917 CGCCCAAGGGGAGCAGGGGCCGG - Intronic
1115807968 14:37073661-37073683 AAGTCCAGGGTAGCAGGGGCAGG - Intronic
1116373195 14:44162394-44162416 AGGCACAGGGCAGCAGGCATAGG + Intergenic
1117131956 14:52695681-52695703 AGGCCCCGGGCTGCCGGCGCGGG - Exonic
1118734185 14:68690348-68690370 AGTCAGAGGGGAGCAGGGGCTGG + Intronic
1118839933 14:69502447-69502469 AGGCATAGGGGAGCAAGTGCTGG - Intronic
1119265643 14:73262065-73262087 AGGTCCAAGGGAGCCGGCCCAGG + Intronic
1119588839 14:75865498-75865520 AGGCTCAGGGGTGCATGCTCAGG - Intronic
1120493447 14:85204959-85204981 GCGCACAGGGGAGCAGGTGCAGG - Intergenic
1121313990 14:92950294-92950316 AGCCCCAGGTGGGCAGGGGCAGG + Intronic
1121457004 14:94044684-94044706 AGGCCGACGTGAGCAGGCGCAGG - Exonic
1121465660 14:94113985-94114007 AGCCCCTGGGGAGCAGGCAGAGG - Intronic
1121558524 14:94856950-94856972 TGGCCCTGGGGAGCAGGTCCGGG + Intergenic
1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG + Intergenic
1122306753 14:100771309-100771331 AGGCCCAGGGGCCCAGGCTGGGG + Intergenic
1122317742 14:100835796-100835818 AGGCCCACAGGAGGAGGCACTGG - Intergenic
1122415677 14:101548510-101548532 AGGCCCTGGGGAGCACGGGCTGG + Intergenic
1122628085 14:103094411-103094433 AGGCCAGCGGAAGCAGGCGCTGG - Intergenic
1122744228 14:103888560-103888582 AGGCCCCGGGGAACAGACGGTGG - Intergenic
1122986179 14:105212687-105212709 GGGCCCAGGGGAGAGGACGCAGG + Intronic
1123006449 14:105326178-105326200 AGGACCAGGGAGGCGGGCGCTGG - Intronic
1123068047 14:105628039-105628061 AGCCACAGGGGAGGAGGGGCAGG - Intergenic
1123068071 14:105628118-105628140 AGCCACAGGTGAGCAGGGGCAGG - Intergenic
1123072022 14:105646660-105646682 AGCCACAGGTGAGCAGGGGCTGG - Intergenic
1123091662 14:105744807-105744829 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091687 14:105744886-105744908 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091712 14:105744965-105744987 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091736 14:105745044-105745066 AGCCGCAGGTGAGCAGGTGCAGG - Intergenic
1123091803 14:105745281-105745303 AGCCGCAGGTGAGCAGGGGCAGG - Intergenic
1123091828 14:105745360-105745382 AGCCGCAGGTGAGCAGGTGCAGG - Intergenic
1123091933 14:105745795-105745817 AGCCACAGGTGAGCAGGGGCAGG - Intergenic
1123092137 14:105746577-105746599 AGCCTCAGGTGAGCAGGGGCTGG - Intergenic
1123097565 14:105773705-105773727 AGCCTCAGGTGAGCAGGGGCAGG - Intergenic
1123097649 14:105774021-105774043 AGCCACAGGTGAGCAGGGGCTGG - Intergenic
1124247048 15:28079830-28079852 AGGCACATGGGGGCAGGAGCTGG - Intronic
1125524811 15:40368185-40368207 CGCCGCAGGGCAGCAGGCGCTGG - Exonic
1125743614 15:41984389-41984411 GGGCCAAGGGCAGCAGGTGCTGG + Intronic
1126098626 15:45106513-45106535 AGTGCCAGGTGAGCAGGGGCTGG - Exonic
1128374319 15:67065058-67065080 CAGCCCAGGGGCGCCGGCGCCGG + Intronic
1128732981 15:70033633-70033655 AGGCCCAGCGCCCCAGGCGCGGG + Intergenic
1128868823 15:71136800-71136822 AGGCCCTGAGGAGAAGGGGCAGG + Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129449224 15:75640637-75640659 AGCCCCAGGAGAGCCGGCTCCGG - Intronic
1129853878 15:78811009-78811031 AGGCACAGCGGAGCCGGCGCGGG + Intronic
1130295721 15:82646434-82646456 AGGGCCGGGGCTGCAGGCGCGGG + Intronic
1130655534 15:85789774-85789796 GGGCTTAGGGGAGCAGGCGTGGG - Intronic
1130808494 15:87352427-87352449 AGGGCCAGTGGGGCAGGCACTGG + Intergenic
1131287656 15:91075072-91075094 AGCCCCAGGGGAGCTGCCACAGG + Intergenic
1132155989 15:99495544-99495566 AGGCCCAGGGGAGCATCCACAGG + Intergenic
1132293397 15:100718678-100718700 AGGGCCAGAGGGGCAGGCGCAGG + Intergenic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132606460 16:795645-795667 AGGCCCAGGTGACCAGGCCTTGG + Intronic
1132690159 16:1178535-1178557 AGGCCAAGGACAGCAGCCGCAGG + Intronic
1132864399 16:2086397-2086419 AGGCCTGGGGCAGCAGGAGCGGG - Intronic
1132938963 16:2497497-2497519 AGCCCCAGGGGAGCAGGGTCAGG + Intronic
1132980550 16:2736805-2736827 AGGCCAAGGGCAGCAGGAGGTGG + Intergenic
1133018289 16:2954982-2955004 AGGCCCCGGGGGGCAGGCCAGGG + Intergenic
1133020096 16:2963456-2963478 AGGGGGAGGGGAGCAGGCCCAGG - Intergenic
1133102004 16:3485498-3485520 AGGGCCAGGGCAGCAGGCAGAGG - Exonic
1133230826 16:4365736-4365758 AGGCCCTGGGGAGGAGCAGCTGG - Intronic
1133303110 16:4795239-4795261 AGGCCCAGGGAGGAAGACGCCGG - Intronic
1134134061 16:11668360-11668382 AGGCCAATGGGAGCCCGCGCTGG - Intergenic
1134531923 16:14990001-14990023 AGGACCAGGGAAGCAGGTGCAGG + Intronic
1136776051 16:32872489-32872511 AGGCCTAGGGCAGCAGGTGATGG - Intergenic
1136894564 16:33989023-33989045 AGGCCTAGGGCAGCAGGTGATGG + Intergenic
1136996540 16:35194738-35194760 AGGCCCAAGGGAGATGGCTCAGG + Intergenic
1138192117 16:55022110-55022132 AACTCCAGGGGAGCAGGTGCTGG + Intergenic
1139465043 16:67149992-67150014 GTGCCCAGGGGCGCAGGCTCGGG - Exonic
1139482217 16:67236838-67236860 AGGCCCAGTGGAGGAGGTGGGGG + Intronic
1139603555 16:68001597-68001619 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1139972314 16:70783771-70783793 ATGCCCAGGGGAGAAGGGGATGG + Intronic
1140406045 16:74712257-74712279 AGGTCCAGGGGGGTAGGCCCTGG - Intergenic
1141129239 16:81423977-81423999 AGGCCCAGGGAAGAAGGCAAAGG - Intergenic
1141838006 16:86555292-86555314 AGGCCCAGGCGCGCATGCTCGGG + Intergenic
1141981086 16:87550876-87550898 CGGCCCAGGGCTGCAGACGCTGG - Intergenic
1142080020 16:88144013-88144035 AGGCGCAGGGGAAACGGCGCAGG + Intergenic
1142113260 16:88343184-88343206 AGGTCCAGGAGAGCAAGTGCAGG - Intergenic
1142184087 16:88686244-88686266 AGGCCCCTGGGAGCGGGGGCTGG - Intronic
1142207886 16:88792595-88792617 AGGCCCAAGGGAGCAGGACAGGG + Intergenic
1142293081 16:89201592-89201614 AGGCGGAGGCCAGCAGGCGCCGG + Exonic
1203078467 16_KI270728v1_random:1134598-1134620 AGGCCTAGGGCAGCAGGTGATGG - Intergenic
1142639796 17:1279370-1279392 CTGCCCAGAGGAGCAGGCCCTGG + Intergenic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1142963727 17:3567573-3567595 AGGCCGAGAGGGGCAGGCGATGG - Intronic
1143178196 17:4968466-4968488 AGGAGCTGGGGAGCAGGGGCAGG + Exonic
1143353745 17:6308921-6308943 ATGCCCAGGGCAGCAGACTCTGG - Intergenic
1143367110 17:6415570-6415592 AGGCCCAGGGAAGGACGCCCCGG + Intronic
1143625907 17:8110051-8110073 GGGCCCAGCGGGGCAGGGGCCGG - Intronic
1143769787 17:9161300-9161322 AGCCCCAGAGGGGCAGGCGAGGG + Intronic
1143796835 17:9343748-9343770 AGGGCCAAGGGAGCAGGAGGAGG - Intronic
1143904306 17:10197604-10197626 TGGACCAGGGGAGCAGGCAGTGG + Intronic
1144519138 17:15942801-15942823 AGGCCTAGTGGAGAAGGCTCTGG - Intergenic
1144630551 17:16870067-16870089 ATGCTCAGGGGAGCCGGCGATGG - Intergenic
1144647039 17:16982131-16982153 AGGACCAGGAGAGCTGGGGCTGG + Intergenic
1145003692 17:19322985-19323007 AGGCTCAGGGGAGCATTCCCTGG + Intronic
1145191535 17:20844314-20844336 AGCCCCTGGGGGGCCGGCGCGGG - Intronic
1146183585 17:30711327-30711349 AGGCCCTGGAGAGCAGGTGGAGG - Intergenic
1147159664 17:38562760-38562782 GGGTCCAGGGGAGCAGGGTCTGG - Intronic
1147168193 17:38604464-38604486 GGAGCCAGGTGAGCAGGCGCGGG - Intronic
1147970959 17:44219046-44219068 AGGCTCGGGGGAGGAGGCGGCGG - Intronic
1148384434 17:47223866-47223888 AGACCCAGGAGAGCAAGCTCTGG + Intergenic
1148496258 17:48054983-48055005 AGCCCCAGGGCAGCCGGTGCCGG - Intronic
1148498803 17:48072892-48072914 AGGCCAAGGTGGGCAGGCCCAGG + Intronic
1148857051 17:50584581-50584603 GGGCCCAGGGGAGCCGGGGGCGG + Intronic
1149564222 17:57630050-57630072 AGGCCCAGGGATGCAGGCCATGG - Intronic
1150124447 17:62627530-62627552 AGGGGAAGGGGAGGAGGCGCGGG - Exonic
1150307294 17:64096555-64096577 TGGACCGGGGGAGCAGGGGCAGG - Intronic
1150804545 17:68308903-68308925 AGGCTGAGGAGTGCAGGCGCAGG - Intronic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1151429006 17:74050087-74050109 AGGCCAAGGGGAGCTGGGGAGGG - Intergenic
1151757990 17:76085594-76085616 GAGCCCAGGGGGGCAGGGGCTGG + Intronic
1151772497 17:76173573-76173595 AGGCCCAGAGAAGCAAGCTCTGG + Intronic
1151961360 17:77407663-77407685 AGGCCCTGGGGCGGAGGAGCAGG - Intronic
1151969694 17:77451304-77451326 AGGGCGAGGGGAGCAGGAGGAGG - Intronic
1152207425 17:78981626-78981648 AGCCCCAGGGGAGCAGATGTTGG - Intergenic
1152235763 17:79137576-79137598 AGGCCCCGGGGGGCAGGCAGTGG - Intronic
1152261708 17:79270716-79270738 AGGCCCAGTGGAGGAGGAACAGG - Intronic
1152433914 17:80263782-80263804 AGGCCCAGGGGTGCTGGTGGAGG + Intronic
1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG + Intronic
1153805215 18:8705060-8705082 GCGCCCTTGGGAGCAGGCGCAGG - Intergenic
1153954091 18:10081331-10081353 AGGCACAGGAGGGCAGGCTCTGG + Intergenic
1154299709 18:13182448-13182470 GGGTCCAGGGGAGCAGCCGCAGG - Intergenic
1154954672 18:21242386-21242408 AGGGCCAGGTGAGCGGCCGCGGG + Intronic
1155368956 18:25078111-25078133 AGGCCTAGGGGAAGAGGCCCAGG + Intronic
1156470351 18:37373832-37373854 AGGCCCAGGTGGGCAGGTACAGG + Intronic
1157098912 18:44711972-44711994 TGGCCCAGGGAAGAAGGGGCAGG - Intronic
1157529228 18:48408140-48408162 AGGCCGAGGGGAGCTGGGGGTGG - Intronic
1157831122 18:50857848-50857870 AGGCCCAGGAGGGCAGGTCCTGG - Intergenic
1158393027 18:57058999-57059021 TGACCCAGGAGAGCAGGCGCTGG - Intergenic
1160453166 18:78979240-78979262 AGGCCCAGGCGGGCTGGCGCGGG + Intergenic
1160686315 19:438572-438594 AGGCCCCGCTGAGCAGGAGCTGG - Intronic
1160782449 19:883862-883884 AGGCCCTGGGGACCGGGCGAAGG + Intronic
1160831005 19:1104826-1104848 AGGCCCCAGCGTGCAGGCGCAGG + Intronic
1160856305 19:1219404-1219426 AGGCCCACGGGTGCGTGCGCGGG + Exonic
1160904603 19:1446305-1446327 AGGCCGAGTGCAGCAGGCTCAGG - Intronic
1160990531 19:1858588-1858610 AGGCCTAGGGGATCAAGCTCTGG + Intronic
1161044280 19:2126798-2126820 AGGCCCTGAGCAGCAGGGGCCGG + Intronic
1161063799 19:2227937-2227959 CGGCCCAGGTGCGCAGGCGGGGG - Intronic
1161076601 19:2288773-2288795 ATGCTCAGCTGAGCAGGCGCTGG + Intronic
1161425034 19:4198535-4198557 AGGGCCCGGGGAGGGGGCGCAGG + Intronic
1162019817 19:7863273-7863295 AGGCCGAGGTGAGCCGGCGCGGG + Exonic
1162304846 19:9865869-9865891 AGAGCCAGGGGAGGAGGGGCAGG - Intronic
1162419422 19:10557743-10557765 AGGCCCAGGTGGGCAGGCCGTGG - Intronic
1162975207 19:14204412-14204434 AGGCCCTGGAGAGCAGGTGGAGG + Intronic
1163015348 19:14451128-14451150 AGGCCCAGGGCTGCAGGGGTGGG - Intronic
1163015459 19:14451532-14451554 AGGCCCAGGCAAGCAGGAACAGG - Intronic
1163028388 19:14527692-14527714 ATTCACAGGGGAGCAGGCGGAGG - Intronic
1163201998 19:15776322-15776344 AAGCCTAGGGGAGAAGGAGCTGG + Intergenic
1163490818 19:17616358-17616380 AGGCACCGGGCACCAGGCGCGGG + Intronic
1163509278 19:17725714-17725736 GGGCCCTGAGGAGCAGGCCCTGG + Intronic
1163748172 19:19060259-19060281 AGGCCCAGGGGAGGACGCTGGGG - Intronic
1163762616 19:19145814-19145836 CGGCCAAGGGCAGCCGGCGCAGG + Exonic
1163777935 19:19228682-19228704 AGGGCTTGGGGAGCAGGGGCTGG + Intronic
1163833908 19:19562097-19562119 AGGCCCAGGGTAGCTGGCAGGGG - Exonic
1163861848 19:19747021-19747043 TGGCCCAGGGGAGGAGGGGCAGG - Intergenic
1164862373 19:31572269-31572291 AGGACCAGTGGAGCAGGCGGAGG - Intergenic
1165427376 19:35753575-35753597 AGGCCTTGAGGAGCAGGGGCTGG + Intronic
1165463809 19:35960109-35960131 TGGCCTAGGGGCGCAGGTGCAGG + Intergenic
1166352032 19:42203798-42203820 AGGGCCAGGGCAGCAGGCAGGGG + Intronic
1166372409 19:42309676-42309698 AGGCCCTGGTGGGCAGCCGCCGG + Exonic
1166739589 19:45105793-45105815 AGTCCCAGGGGGTCAGGCCCGGG + Intronic
1166749189 19:45156636-45156658 GGGCCCTGGGGACCAGGCACTGG + Intronic
1166943473 19:46383251-46383273 AGGCCTGGGGGAGCGGGAGCAGG - Intronic
1167250503 19:48396366-48396388 AGGCCCAGGAGGGCAGCCCCCGG - Intronic
1167467489 19:49658036-49658058 AGGGCCAGCGGAACAGGCCCAGG - Intronic
1167472984 19:49685707-49685729 AGAGCCAGGGGAACTGGCGCAGG + Intronic
1168144883 19:54415441-54415463 GGGCTCAGGGGAGCGGGAGCGGG - Intronic
1168240001 19:55084106-55084128 AGACCCAGAGGAGCAGGCTTGGG + Intronic
925465454 2:4104268-4104290 AGGCACAGGGGACCAGGGGTTGG + Intergenic
925878102 2:8328865-8328887 AGGCCGAGGGCAGCAGGGGCTGG + Intergenic
927180328 2:20441849-20441871 AGGCCGAGGGGAACAGGCAATGG - Intergenic
927909593 2:26887438-26887460 AGGCCCAGGGGAGCTGGGGAAGG + Intronic
928366271 2:30705804-30705826 AGGGCCAGGGAGGCAGGAGCTGG - Intergenic
929549140 2:42878377-42878399 AGGCCCAGGGTAGGAGGGTCTGG + Intergenic
929588903 2:43132782-43132804 AGGGCCCGGGGAGCTGGCCCAGG + Intergenic
929627439 2:43423871-43423893 AAGCCCAGAGAAGCAGGCCCTGG + Intronic
931253775 2:60553841-60553863 GGGCCGAGGGGAGGGGGCGCTGG + Intergenic
931670510 2:64643084-64643106 AGCCCCAGGGGTGCAGGACCAGG - Intronic
931893637 2:66704048-66704070 AGGCTCAGGAGAGTAGGGGCGGG - Intergenic
932292540 2:70594691-70594713 AGGACCAGAGGAGCTGGGGCTGG + Intergenic
932331659 2:70901372-70901394 TTGCCCAGGGGAGACGGCGCGGG + Intronic
933849750 2:86356373-86356395 GGGCCAGGGGGAGCAGGTGCAGG + Intergenic
934559197 2:95303586-95303608 AGGCCCAGGAGAGCGGGGGAAGG - Intronic
934619793 2:95797136-95797158 GAGGGCAGGGGAGCAGGCGCGGG - Intergenic
934641095 2:96027421-96027443 GAGGGCAGGGGAGCAGGCGCGGG + Exonic
934664857 2:96163239-96163261 AGGCCAAGGGGGGCAGGCTCAGG + Intergenic
934951264 2:98577122-98577144 AGGCCCTGGAGTGCATGCGCAGG + Exonic
935112178 2:100104320-100104342 CGGCCCAGGTGAGGACGCGCGGG + Intronic
936122799 2:109760831-109760853 CGGCCCAGGTGAGGACGCGCGGG - Intergenic
936140101 2:109932132-109932154 AGGCCCAAGGGAGAAGGGGGAGG - Intergenic
936176790 2:110230077-110230099 AGGCCCAAGGGAGAAGGGGGAGG - Intergenic
936204595 2:110439354-110439376 AGGCCCAAGGGAGAAGGGGGAGG + Intronic
936221892 2:110610633-110610655 CGGCCCAGGTGAGGACGCGCGGG + Intergenic
937702614 2:124881284-124881306 TGGAACAGGGGAGCAGGTGCAGG + Intronic
937907612 2:127059840-127059862 AGGCACAGGGGCGAAGGTGCAGG + Intronic
938067387 2:128288586-128288608 AGGCCCAGGGCACCTGGCGCGGG - Intronic
939275519 2:139992507-139992529 AGGTCGAGGGCAGCAGGGGCAGG + Intergenic
939953961 2:148509487-148509509 TGGCCCTGGGGGGCAGGCTCCGG + Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947791700 2:232872504-232872526 TGACCCAGGGAAGCAGGGGCTGG - Intronic
948423919 2:237876311-237876333 AGGCCCAGGGGGCCAGGCGGTGG + Intronic
948628260 2:239284030-239284052 AGGCCCTGGGGTGCAGAAGCGGG - Intronic
948768818 2:240236922-240236944 AGGCACAGGGGTGCAGGGGAGGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
948803433 2:240443018-240443040 AGGCCCACGGCAGGAGGGGCTGG - Intronic
948865665 2:240773517-240773539 AGGCCCAGGTGAGAAGGGACAGG + Intronic
948919210 2:241053443-241053465 AGACTGAGGGGAGCAGGGGCAGG - Intronic
948972668 2:241441475-241441497 AGGCGCAGTGGAGCAGTGGCTGG + Exonic
949026401 2:241768302-241768324 GCGGCCTGGGGAGCAGGCGCTGG + Exonic
949031489 2:241799349-241799371 GGGCTCTGGGGAGCAGGGGCCGG + Intronic
949042890 2:241857685-241857707 AGGTGCCGGGGAGCAGGCCCCGG + Intronic
1168769714 20:407812-407834 AGGCTTGGGTGAGCAGGCGCCGG + Intronic
1170634632 20:18093592-18093614 CAGCCCAGGGGATCAGGCCCAGG + Intergenic
1171173596 20:23035463-23035485 ATGACCAGGGGTGCCGGCGCAGG - Exonic
1171896295 20:30813269-30813291 ACGCACAGGGGCGCACGCGCGGG + Intergenic
1172442821 20:34977930-34977952 CGGCCCAAGGCAGCAGGCACTGG - Exonic
1173139606 20:40470696-40470718 ACTCCCAGGGGGGCAGGCGCTGG - Intergenic
1173453073 20:43182269-43182291 AGGTCCTGGGAAGCAGGAGCTGG + Intronic
1173571795 20:44081798-44081820 AGGACCTGGGGAGGAGGGGCAGG - Intergenic
1173729121 20:45316608-45316630 GGGCCCCGGGGAGCAGGGGAAGG + Intronic
1173872732 20:46351953-46351975 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1175256990 20:57653440-57653462 AGGCCCAGGGGAGTGGGGCCAGG - Intronic
1175336043 20:58197053-58197075 AGGCCCAGGAGAGGTGGCCCCGG - Intergenic
1175336061 20:58197101-58197123 AGGCCCAGGAGAGGTGGCCCCGG - Intergenic
1175384167 20:58583696-58583718 TACCCCAGGGGAGCAGGAGCAGG + Intergenic
1175399477 20:58692593-58692615 AGGCCCAGGGGCGGCGCCGCTGG + Exonic
1175862352 20:62157128-62157150 AGGCCGTGGGGAGCAGGCACAGG - Intronic
1177894543 21:26844420-26844442 CGCCCCAGGGGAGAAGCCGCCGG - Exonic
1178687593 21:34723552-34723574 AGGCCCAGGGCAGCCTGTGCAGG + Intergenic
1179024356 21:37667637-37667659 AGGTCCAGGGTAGCAGGCGCCGG + Intronic
1179106396 21:38404466-38404488 GGGCCCGGGGGAGAAGGAGCAGG + Intronic
1179226050 21:39454492-39454514 AGACCCTGGGGAGCAGGAGAGGG + Intronic
1179627413 21:42656485-42656507 AGGCCCCGGGCAGCAAGTGCCGG + Intronic
1179644873 21:42769861-42769883 AGGCTGTGGGGAGCAGGCTCTGG - Intronic
1179785518 21:43727774-43727796 AGGCCCTGTGGAGCAGACTCTGG + Intronic
1179942386 21:44648616-44648638 AGGCACAGGGGAGTCGGCACAGG + Intronic
1180002560 21:45001949-45001971 AGGCCTAAGGGGGCAGGGGCAGG - Intergenic
1180088943 21:45524097-45524119 AGGCCCAGGGGTGAACGCTCAGG - Intronic
1180088991 21:45524286-45524308 AGGCCCAGGGGTGAACGCTCAGG - Intronic
1180089071 21:45524589-45524611 AGGCCCAGGGGTGAACGCTCAGG - Intronic
1180733766 22:18001048-18001070 AGTTCCGGGGCAGCAGGCGCGGG - Intronic
1180986158 22:19904869-19904891 GGGGCCAGGGGAGCAGCCCCGGG + Intronic
1181001888 22:19991650-19991672 AGCCCCAGGGGAGCAGGCGGGGG + Intronic
1181007963 22:20023165-20023187 TGCACCAGGGGAGCAGCCGCTGG - Intronic
1181053305 22:20247697-20247719 AGGGCCAGGGCATCAGGGGCTGG - Intronic
1181120759 22:20667742-20667764 AGCCCCTGGGGGGCCGGCGCGGG + Intergenic
1181274105 22:21677679-21677701 AGACCCTGGGGAGCGGGAGCGGG + Intronic
1181325080 22:22038701-22038723 AGGCCCAGGGGAGGAGCCCTGGG + Intergenic
1181333724 22:22114769-22114791 AGCCCCTGGGGGGCCGGCGCGGG + Intergenic
1181491543 22:23263330-23263352 AGGCCCAGGCTATCTGGCGCCGG - Intronic
1181969873 22:26681834-26681856 AGATCCAGGGGTGCAGGTGCTGG - Intergenic
1182043085 22:27253583-27253605 ACACCCAGGGGAGCAGGGGTGGG + Intergenic
1183363627 22:37395818-37395840 AGGCCCAGGGTGGGAGGGGCAGG + Intronic
1183458022 22:37933225-37933247 AGGGCCAGAGGAGGAGGTGCGGG + Intronic
1183601720 22:38843937-38843959 GGGCCGAGCGGGGCAGGCGCGGG + Exonic
1183738462 22:39656946-39656968 AGTCCCAGGGGAGCCGTGGCAGG + Intronic
1184043348 22:41957528-41957550 AGGTCCAGGAGAGCAAGGGCGGG - Intergenic
1184176956 22:42794082-42794104 AGGCCCAGGGGAGGAGCAGAGGG - Intergenic
1184655495 22:45939917-45939939 ATGCCCAGAGGAGCAGGAGTTGG + Intronic
1184685618 22:46095384-46095406 AAGCCCAGGGCAGCAGGTGAGGG + Intronic
1184757792 22:46526649-46526671 GGGCCCACGGGTGCAGGCCCTGG - Intronic
1184872192 22:47247856-47247878 AGGTCCAGGAGAGCAGGTCCAGG + Intergenic
1184872194 22:47247870-47247892 AGGTCCAGGTGAGCAGACACAGG + Intergenic
1184934243 22:47707287-47707309 AGGCCCATGGGCACAGGCCCTGG + Intergenic
1185271935 22:49933856-49933878 AGGTCCTGGGGAGCCGGGGCAGG + Intergenic
1185282798 22:49982930-49982952 AGGCCTAGGGGAGCTGGGGACGG + Intergenic
1185365184 22:50433904-50433926 AGGGCCGGGGGCGCAGACGCTGG + Intronic
1185365269 22:50434152-50434174 AGGGCCGGGGGCGCAGACGCTGG + Intronic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
950172562 3:10849409-10849431 AGGCCCAGGAGACCAGGAGAAGG - Intronic
950484285 3:13263964-13263986 AAGCCCAGGCGGACAGGCGCAGG - Intergenic
950484375 3:13264402-13264424 AGACCCAGGAGAGCAGGCAGCGG - Intergenic
950660036 3:14461543-14461565 ACGCACAGGGGAGGAGGCCCCGG + Intronic
953435841 3:42876517-42876539 AGGTCCAGGGGAGCAGGCAAAGG - Intronic
953528179 3:43712974-43712996 ATGCCCAGGAAAGCAGGCCCTGG - Intronic
953786838 3:45917374-45917396 AGGCCCAGAGGGGCATGCCCTGG - Intergenic
953881604 3:46693897-46693919 AGGCCCCTGGGACCCGGCGCGGG + Intergenic
954107899 3:48419160-48419182 AAGCCCTGGGGAGCAGGAGGAGG - Intronic
954112790 3:48444808-48444830 AGGTCCAGGGCAGCAGCTGCGGG + Intergenic
954316500 3:49804378-49804400 AGGCCCCAGGGAGCATGCCCTGG + Exonic
954465892 3:50654516-50654538 AGGCCCAGGGGCTGAGGGGCTGG + Intergenic
954681892 3:52350365-52350387 TGGGCCAGGGGAGGAGGCCCAGG - Intronic
954806543 3:53224123-53224145 AGAGCCTGGGCAGCAGGCGCCGG - Intergenic
955345061 3:58154805-58154827 TGGACCCGGGAAGCAGGCGCTGG + Exonic
955984567 3:64559307-64559329 AGGCCCAGGGCAGCTGGAGGTGG - Intronic
959462508 3:106644115-106644137 TGGTCCATGGGAGCGGGCGCGGG - Intergenic
960096689 3:113696493-113696515 AGCCCCGGAGGAGCAGGCGGTGG - Exonic
961518676 3:127454724-127454746 TGGCTCAGGGGAGCAGGTCCAGG + Intergenic
961674221 3:128555183-128555205 AGGCCCAGGGGATTGGGCTCAGG + Intergenic
962282375 3:134061563-134061585 AGGACCAGGGAGGCAGGGGCTGG + Intergenic
962738790 3:138348394-138348416 GGGCCCAGGGGACTCGGCGCGGG + Intronic
963008890 3:140751125-140751147 AGGCCCAGAGGAGCTGGTGGGGG + Intergenic
963038309 3:141051160-141051182 TGGCACAGGGGCGCGGGCGCGGG + Intergenic
963547023 3:146672213-146672235 AATCCCAGGGGAGCAGGCTAGGG + Intergenic
963872116 3:150428329-150428351 AGGCCCAGGGTAGGAGGGGCAGG + Intronic
965444893 3:168763391-168763413 AGGCCCATAGGGGCAGGCCCAGG + Intergenic
968094348 3:195917583-195917605 AGGCCCAGAGGAACACTCGCAGG + Intergenic
968136013 3:196220062-196220084 AGGCCCAGGGGAGCGAGGTCTGG + Intronic
968280366 3:197472480-197472502 AGGCCCAGGGGAGCCCTTGCTGG + Intergenic
968438854 4:611326-611348 AGTGTCAGGGGAGCAGGTGCTGG + Intergenic
968438888 4:611530-611552 AGTGTCAGGGGAGCAGGTGCTGG + Intergenic
968515411 4:1013540-1013562 AGGCCCATGTGGGCAGGCGGGGG - Intronic
968570541 4:1338195-1338217 AGGCCGGGGTGAGAAGGCGCAGG + Intronic
968584356 4:1409230-1409252 AGGTTCAGAGGAGCAGGGGCCGG + Intergenic
968614735 4:1572333-1572355 AGGCCCAGGAGTGGAGGAGCTGG - Intergenic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
969130520 4:4987752-4987774 AGGCTCAGTGGAGTTGGCGCTGG + Intergenic
969205251 4:5639045-5639067 AGGAGCAAGGGAGCAGGTGCAGG + Intronic
969444997 4:7239609-7239631 AGCCCCTGGGGAGCTGGGGCTGG + Intronic
969498251 4:7538468-7538490 CGGCCCAGAGGAGCTGGCCCAGG + Intronic
969511591 4:7620985-7621007 AGGCCCAGGGAGGCAGTGGCTGG + Intronic
969618455 4:8267132-8267154 AGGCCAACGTGTGCAGGCGCAGG - Intergenic
969699654 4:8761201-8761223 CAGCCCAGGGGAGCAGCAGCAGG - Intergenic
972654772 4:41054059-41054081 AGGCCCAGGGCTGCAGGTGTTGG + Intronic
975735165 4:77373555-77373577 AGTCCCAGGGCAGCAGGAGGAGG + Intronic
976851605 4:89553418-89553440 AGGCTCAGGGGTGCATGTGCAGG + Intergenic
979424702 4:120550769-120550791 AGGCACAGTGGAGCAGGGGGTGG + Intergenic
980051880 4:128047591-128047613 AGGCGCCGGGGAGCAGGGGGCGG + Intergenic
980554431 4:134384213-134384235 ATGGGCAGGGGAGCAGGTGCAGG - Intergenic
980698795 4:136395645-136395667 GGGCGCAGTGGAGCAGGCGGCGG - Intergenic
981094918 4:140769287-140769309 AGGTCCAGGGGGTCAGGCGGAGG + Intergenic
981300991 4:143185408-143185430 AGGGCCAGGGGATAAGGAGCGGG - Exonic
982024144 4:151235065-151235087 AGGTTCAGGGGTGCATGCGCAGG + Intronic
983929236 4:173434946-173434968 AGGCCCAGGGGTTCAGGCTGGGG + Intergenic
984698150 4:182799666-182799688 AGGTGCAGGTGAGCCGGCGCCGG + Exonic
985111898 4:186555153-186555175 TGGCCCAGGGGAGGCGGCGCGGG + Intronic
985591577 5:768143-768165 AGGAAGAGGGGAGCAGGGGCTGG + Intergenic
985603954 5:848862-848884 ACGCCCAGGTGAGCAGGGCCAGG - Intronic
985603959 5:848876-848898 AGGCCCAGGTGAGCACGCCCAGG - Intronic
985609287 5:877947-877969 AGGCCCAGGAGAGAGGGCTCGGG + Intronic
985609493 5:879102-879124 AGGAAGAGGGGAGCAGGGGCTGG + Intronic
985657096 5:1137833-1137855 AGGCCCCGGGGAGCTGGTGCCGG - Intergenic
985703214 5:1386082-1386104 AGGGCCCGGGGCACAGGCGCGGG - Intergenic
986000020 5:3623061-3623083 GAGCCCACGGGAGCAGGCTCTGG + Intergenic
986022926 5:3821721-3821743 GGGCACAGGTGAGCAGGTGCAGG - Intergenic
986123970 5:4868231-4868253 AGTCACAGGGGAGGAGGTGCAGG + Intergenic
988577911 5:32444519-32444541 AGGCTCCGGGGAGGAGGCGGCGG - Intronic
989264356 5:39455817-39455839 AGTCCCAGGGGTGCGGTCGCCGG - Intronic
990463207 5:56048294-56048316 AGCCGCAGGTGAGCAGGTGCAGG - Intergenic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
992990046 5:82274603-82274625 AGGCCCTGGGCGTCAGGCGCGGG - Exonic
993848671 5:92978025-92978047 AGGCACATGGGAGCAGGGGGTGG + Intergenic
997616174 5:135247639-135247661 TGGCCCAGAGGAGCAGGCCAAGG + Intronic
998179817 5:139928746-139928768 AGAGCCAGAGGAGCAGGCTCAGG - Intronic
998367027 5:141638202-141638224 AGGCCCTGGGGGGCGAGCGCGGG - Exonic
999194244 5:149771305-149771327 AGGCCCCTGGAAGCAGGCTCAGG + Intronic
999434274 5:151550906-151550928 AGCCCCAGGGGAACAGGGACTGG + Intronic
1000040893 5:157484496-157484518 AAGTCAAGGGGAGCAGGCACTGG - Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001523577 5:172413125-172413147 AGTCCCAGCGGAGCCGGAGCAGG + Intronic
1001702824 5:173719942-173719964 AGGCTGAGGGGAGCAGGTGCCGG + Intergenic
1002000551 5:176194341-176194363 AGGTCTGCGGGAGCAGGCGCCGG - Intergenic
1002294306 5:178221674-178221696 AGGCCCAGAGGAGGAAGGGCAGG - Intronic
1002350178 5:178577602-178577624 AGGCAGCGGGGGGCAGGCGCGGG - Intronic
1002460617 5:179371797-179371819 GGGGCCTGGGGAGCAGGGGCTGG - Intergenic
1002632595 5:180591246-180591268 AGGCCGCGGGCTGCAGGCGCGGG + Intronic
1002721759 5:181265588-181265610 AGGCTGAGAGGAGCAGGGGCTGG + Intergenic
1002799825 6:511728-511750 AGGCTCAGGGCAGCAAGGGCAGG + Intronic
1003098936 6:3162784-3162806 AGGTCCAGGGCAGAGGGCGCTGG + Intergenic
1003113270 6:3266216-3266238 TGGCTCAGGGGCGCAGGTGCAGG - Intronic
1003426062 6:5999262-5999284 AGGCGCAGGGGCGCAAGCCCGGG - Intronic
1005987497 6:30884025-30884047 AGGCAAAGGGGAGCAGCCCCAGG - Intronic
1006199142 6:32270745-32270767 AGGCCCAAGGGAAGAGGGGCTGG - Intergenic
1006451018 6:34105710-34105732 TAGCCCAGGGGAGCAGCAGCTGG - Intronic
1006582865 6:35086792-35086814 AGGCCCCTGGGGGCAGGCGGAGG - Intronic
1007426335 6:41748587-41748609 TGGGCCAGGTGAGCAGGCACTGG - Intronic
1007615306 6:43176332-43176354 AGGCCCAGGGCAGGAGGAGGAGG + Intronic
1008242196 6:49127394-49127416 AGGCCCAGAGGAGAAGGTGTAGG + Intergenic
1008595765 6:53040188-53040210 AGGCCCTGGGTAGCAGGAGGTGG - Intronic
1009418780 6:63442981-63443003 AGGCACTGTGGAGCAGGCGGCGG + Intergenic
1011192130 6:84740177-84740199 AGGCCAGGTGGAGCAGGTGCAGG - Intronic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1017103099 6:150865740-150865762 CGTGCCAGGGGAGCAGGCGGCGG - Exonic
1017446315 6:154510203-154510225 GGGCGCAGGGGAGCAGCCGCGGG - Exonic
1018003518 6:159600071-159600093 AGGGCCAGAGGAGCAGAGGCAGG + Intergenic
1018025846 6:159805119-159805141 CGGCCTAGGGGAGCAGGGTCAGG - Intronic
1018559730 6:165089171-165089193 AGTCCCAGGGCACCAGGAGCAGG - Intergenic
1018733914 6:166673248-166673270 AGGACCAGGGGTGCAGGCTGCGG + Intronic
1018790363 6:167143529-167143551 AGGCCGGAGGGAGCAGGCACAGG + Intergenic
1018823538 6:167392834-167392856 AGGCACAGGTGAGGAAGCGCAGG - Intergenic
1018823547 6:167392876-167392898 GGGCCCAGGTGAGGGGGCGCAGG - Intergenic
1018823617 6:167393123-167393145 AGGCACAGGTGAGGGGGCGCAGG - Intergenic
1018899214 6:168042880-168042902 AGGCCAAGGTGAGACGGCGCAGG - Intronic
1018957291 6:168418765-168418787 AGGCCCTGGGGAGCCTGGGCAGG - Intergenic
1019110045 6:169702280-169702302 AGGCCCCGGGGAGGAGGGGTGGG - Exonic
1019268716 7:133920-133942 AAGCCCAGGGAAGCAGGAGTGGG + Intergenic
1019282820 7:209017-209039 AGCTGCAGGCGAGCAGGCGCCGG + Intronic
1019316650 7:390084-390106 AGGGACAGGGGACCAGGCTCCGG + Intergenic
1019418200 7:936940-936962 AGGCCCAGTGGGGCTGGGGCTGG + Intronic
1019420764 7:949702-949724 AGGGCCTGGGCACCAGGCGCAGG + Intronic
1019523850 7:1472069-1472091 GGGCCCAGGGGAGCTGGAGGTGG - Intronic
1019556293 7:1633199-1633221 AGACCCAGGGGAGCGGGGGGGGG + Intergenic
1019611753 7:1940228-1940250 AGGCCCAGGGGAGAGGGAGGCGG + Intronic
1019615722 7:1959487-1959509 AGGCCCAGGAAAGAAGACGCTGG + Intronic
1019681942 7:2355239-2355261 GGCCCCAGGAGAGCAGGCTCGGG + Exonic
1019733581 7:2639917-2639939 AGCCCCAGGGGTGCAGCCACGGG - Intronic
1020016526 7:4834918-4834940 AGGCCCGGGCGGGCAGGGGCTGG + Exonic
1020093051 7:5352125-5352147 AGTCACAGGGCAGCAGGAGCTGG + Intronic
1020617341 7:10476403-10476425 CGGCCCAGGGGTGCTGGAGCCGG - Intergenic
1021958894 7:25852913-25852935 AGGCACAGGGCGGCGGGCGCAGG - Intergenic
1023074899 7:36472980-36473002 AGGCACAGGGCAGCAGGCATAGG - Intergenic
1023931319 7:44708230-44708252 AGGCCGGGGGGAGCAGGAGGAGG + Exonic
1023969188 7:44978842-44978864 AGGCCCAGGGCAGGAGGCAGTGG - Intronic
1024603626 7:51008061-51008083 AGCCACAGGGCAGCAGGCCCAGG - Intergenic
1024991020 7:55234557-55234579 AGGCCCTGGGAAACAGGAGCAGG + Intronic
1026516621 7:71078330-71078352 TGGTCCATGGGACCAGGCGCGGG - Intergenic
1026841307 7:73671253-73671275 AGTCCAAGGGGGGCAGGCTCCGG - Exonic
1027198551 7:76048060-76048082 AGGCCCCAGAGAGCAGGCGCTGG + Exonic
1027333839 7:77127225-77127247 AGGCCCAGGTCAGCAGCTGCTGG + Intronic
1027420739 7:78015437-78015459 AGTATCAGGGGAGCAGGGGCAGG + Intergenic
1028417672 7:90596746-90596768 AGGCCGAGGGGAGCGGGCGCTGG - Intronic
1029537696 7:101165728-101165750 AGGCCCCAGCGCGCAGGCGCAGG - Intergenic
1029647630 7:101868371-101868393 CAGCCCAGGGGAGGAGGCGCTGG - Intronic
1031564409 7:123277545-123277567 AGCCACAGAGCAGCAGGCGCCGG - Intergenic
1031901420 7:127415304-127415326 AGGCCTAGGGCACCAGGGGCTGG + Intronic
1031982275 7:128135761-128135783 AGATCCAGGGGAGCAGGCGGGGG - Intergenic
1032074860 7:128831482-128831504 GGGCCGAGGGGAGCTGGCGCGGG + Intronic
1034406180 7:150903755-150903777 GGGCCCAGGGTGGCAGGCCCAGG + Intergenic
1034467779 7:151239884-151239906 AGTCCCAGGGGAGGAGGGGATGG + Intronic
1034469776 7:151248965-151248987 AGGCCCGCGGGAGGCGGCGCGGG + Exonic
1034845190 7:154438062-154438084 AGGAACCAGGGAGCAGGCGCTGG + Intronic
1035081473 7:156219835-156219857 AGGCCCAGAGGGGCAGGTGTGGG - Intergenic
1035253759 7:157613505-157613527 AGGCCCAGGAGAGCAGGGTCCGG + Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035363253 7:158328244-158328266 AGGCCCAAGGAAGCAGGCACTGG + Intronic
1035436792 7:158865460-158865482 AGGCCCTGGGGAGCTGGTGCTGG + Intronic
1037826075 8:22161475-22161497 AGCCACAGGGCAGCAGGGGCAGG + Intronic
1037910742 8:22742273-22742295 AGGACCAGGGGCGCAAGAGCTGG - Intronic
1037917044 8:22779037-22779059 AGGCCCTGGGGAGTAGGTGGTGG + Intronic
1037959106 8:23083252-23083274 AGGCACAAGGGAGCTGGGGCTGG - Intergenic
1038446871 8:27610667-27610689 AGGCCCTGGGGAGCTGCTGCAGG - Intronic
1038540204 8:28385449-28385471 AGGGCCAGGGGCGCGGGCGGAGG + Intronic
1039816730 8:41100983-41101005 TGGCCGAAGGGAGCAGGCCCAGG - Intergenic
1039839161 8:41281201-41281223 AGGCCTTGGGGAGGAGGTGCAGG - Intronic
1039888348 8:41668299-41668321 AGGCCAAGAAGAGCAGGTGCAGG - Exonic
1039945364 8:42124118-42124140 AGGACCAGAGGAGCAGGGACAGG - Intergenic
1040582077 8:48706305-48706327 AGACCCAGGTGGGCAGGCACAGG - Intergenic
1041010847 8:53542146-53542168 AAGCCAAGGGCAGCAGGCTCTGG - Intergenic
1043155064 8:76768616-76768638 AGGCACAGAGGAGCAGATGCAGG + Intronic
1044707602 8:95024137-95024159 AGGCCCAGACAAGCAGGCTCTGG + Intronic
1046490310 8:114943606-114943628 AGGCCATGGGGAGCAGGTGAGGG - Intergenic
1048381506 8:133869893-133869915 AAGCCAAAGGGAGCTGGCGCTGG - Intergenic
1048617271 8:136090945-136090967 CGGCACAGGGAAGCAGGCGCAGG - Intergenic
1049056048 8:140238438-140238460 AGCTCCAGGGAAGCAGGAGCAGG + Intronic
1049277740 8:141728368-141728390 AGGCCCCGGGTAGCAGCAGCTGG - Intergenic
1049298282 8:141855432-141855454 AGCTCCAGGGGTGCAGGGGCAGG + Intergenic
1049396411 8:142403089-142403111 AGGCCCAGGTGAGGCGGCGGCGG - Exonic
1049465389 8:142749125-142749147 GGGCCCCTGGGAGCAGGCCCTGG + Intergenic
1049498115 8:142946201-142946223 GGGCCCAGGGCACCAGGCCCAGG - Intergenic
1049541356 8:143210601-143210623 GAGCCCAGGGGCGCAGGTGCAGG + Intergenic
1049564488 8:143331171-143331193 ACGCCCAGGGAACCAAGCGCAGG + Intronic
1049746422 8:144265131-144265153 CCGCCCAGGGGAGCAGGTGAGGG + Intronic
1049791773 8:144475568-144475590 TGGCCCAGGTGAGCGGGCCCCGG - Exonic
1050377007 9:4984595-4984617 AGGCCGAGGGGAAGTGGCGCCGG - Intergenic
1052733678 9:32318613-32318635 AGGCCCAAGGTAGCAGGGGCAGG + Intergenic
1052949738 9:34198826-34198848 AGGCCCAGGGGATCACTCTCTGG + Intronic
1053163347 9:35828748-35828770 CGGGCCAGGAGAGTAGGCGCCGG + Intronic
1056399857 9:86216081-86216103 GGGCCCAGGGCACCAGGCCCAGG + Intergenic
1056709703 9:88980991-88981013 ATGCCCAGGAGAGCAGTTGCTGG + Intergenic
1056815546 9:89798387-89798409 AGGCCCAGAGGAGCTGACCCTGG - Intergenic
1057026410 9:91737069-91737091 AGGCCCGGGGCAGGAGGCCCTGG + Intronic
1057290462 9:93802951-93802973 AGGGCCAGGTGAGCAGGTGGAGG - Intergenic
1057316911 9:93975435-93975457 AGGTCCAGAGGCGCAGGGGCGGG - Intergenic
1058951833 9:109911072-109911094 AGGTGCAGGGGTGGAGGCGCTGG + Intronic
1059176770 9:112175261-112175283 AGGGCCCCGGGAGGAGGCGCGGG - Exonic
1059544308 9:115160894-115160916 AGGCCCATGGCAGTAGGAGCAGG - Intronic
1059732829 9:117073747-117073769 GGGCCTGGGGGAGCAGGCGGTGG + Intronic
1060154607 9:121310638-121310660 TAGCCCAGGGGAGAAGGCCCAGG - Intronic
1060412337 9:123408103-123408125 TGGCCCAGGGTAGCAGGGGCTGG - Intronic
1061188547 9:129069143-129069165 AGGCCCGGGGGAGCACGAGCTGG + Intronic
1061307324 9:129739655-129739677 AGGCGCAGGGGAGCTGGGCCAGG + Exonic
1061955437 9:133959042-133959064 AGCCCCAGGGGCCCAGGCCCAGG + Intronic
1061974399 9:134061122-134061144 AGACCCAGAGGGGCAGGAGCAGG + Intronic
1062004486 9:134232327-134232349 GGGCCCGGGGGAGCAGGAGGGGG - Intergenic
1062015188 9:134287766-134287788 AGGCCCAGGGGAGAAGTGGAGGG - Intergenic
1062068044 9:134539465-134539487 AGGCCCTGGAGGGCAGGAGCGGG + Intergenic
1062191952 9:135252701-135252723 AGGCCCAGCGGAGCAGCTGATGG - Intergenic
1062441073 9:136570114-136570136 AGGCCCAGGGATGCAGGGTCGGG - Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1202799631 9_KI270719v1_random:163490-163512 TGGCCCAGGGGTGCTGGAGCCGG + Intergenic
1185548767 X:967008-967030 ATGCCCAGGTGGGCAGGCCCAGG - Intergenic
1186130964 X:6464922-6464944 AGGGCCAGAGGAGCAGGTCCTGG + Intergenic
1186496348 X:10015238-10015260 CGGCCCGGGCGAGCAGGGGCAGG - Intergenic
1187698077 X:21940781-21940803 ATGCCTGGGGGAGCAGCCGCGGG - Exonic
1190444971 X:50515048-50515070 AGGCCCAGGTTTGCAGCCGCAGG + Intergenic
1192501909 X:71660148-71660170 AGGCCCAGGGCACCATACGCAGG - Intergenic
1193067479 X:77275210-77275232 AGCCTCAGGGCAGCAGGCACAGG - Intergenic
1193694907 X:84696527-84696549 AGGCCCAGAGAAGCAGGAGTAGG + Intergenic
1194623518 X:96201773-96201795 AGGCCCAGGAGACCATGCCCTGG + Intergenic
1195708165 X:107753070-107753092 AGGCCCAGGGGACAAGTCCCAGG - Intronic
1195884611 X:109625386-109625408 AGGCCCCAGGCAGCAGACGCTGG + Intronic
1197709341 X:129654650-129654672 CGGCCCCGGCGAGCCGGCGCGGG + Exonic
1199951981 X:152714643-152714665 CGGCGGAGGGAAGCAGGCGCAGG + Exonic
1199957702 X:152753805-152753827 CGGCGGAGGGAAGCAGGCGCAGG - Exonic
1199966507 X:152824900-152824922 AGGTGCAGGGGAGCAGGGGTAGG - Intergenic
1200103828 X:153701548-153701570 AGGCCTAGGGCAGCAGGTGATGG + Intronic
1200150661 X:153949878-153949900 AGCCCCAGGGGAGCTGGAGCAGG + Intronic
1200213984 X:154359392-154359414 TGGACCAGGGGAGCTGGCACGGG - Exonic