ID: 1000343958

View in Genome Browser
Species Human (GRCh38)
Location 5:160298842-160298864
Sequence CAGAATATAGGACATTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000343958 Original CRISPR CAGAATATAGGACATTTATC AGG Intronic
900860954 1:5230613-5230635 AAGAATTTAAGGCATTTATCTGG - Intergenic
902113946 1:14105926-14105948 CAGAAAAGAGGTCATTTATTAGG - Intergenic
904118211 1:28177610-28177632 CAGAATATAGAACATTCTACTGG - Intronic
907042194 1:51271923-51271945 CAGAATATAGCACTTATAACAGG - Exonic
909155702 1:72073010-72073032 TTGTATATAGGACATTTATTGGG + Intronic
910902771 1:92140124-92140146 AAGAATATAGGGCATTTGCCAGG + Intronic
911448570 1:98033887-98033909 CAGAATATAGGATATGTGACAGG + Intergenic
911496909 1:98643062-98643084 CAGAATTTAGGAGATTCATTAGG + Intergenic
911756745 1:101566836-101566858 AAGAATACATGACACTTATCTGG + Intergenic
912272232 1:108223272-108223294 CAGAATGTAGAACATTGAACAGG - Intergenic
912295987 1:108471049-108471071 CAGAATGTAGAACATTGAACAGG + Intergenic
916796527 1:168172530-168172552 GTGAATTTAGGACATTTATTTGG + Intergenic
917760615 1:178153030-178153052 CAAAATGTATGAAATTTATCTGG - Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918519670 1:185402052-185402074 CACAGTAGAGGAAATTTATCAGG - Intergenic
919055650 1:192566610-192566632 CAGAATACAGCACTTGTATCAGG - Intergenic
919168536 1:193925906-193925928 CAGAATATAGTAGATTTTTAGGG - Intergenic
919596994 1:199576705-199576727 CAGAAGACAAGACTTTTATCAGG + Intergenic
919840238 1:201603699-201603721 CAGCATTTAGGACATCTACCGGG + Intergenic
921135125 1:212253225-212253247 CAGAATGTAGGACATTCTACAGG + Intergenic
1064600677 10:16989421-16989443 CATAATATATTACATATATCTGG + Intronic
1065845371 10:29738647-29738669 AAGAATATAGGGGATCTATCAGG + Intergenic
1069190511 10:65481923-65481945 CATAATTTAGGACATTTGGCAGG - Intergenic
1070267448 10:74917726-74917748 CAGAAGAAATGACATTGATCTGG + Intronic
1071751587 10:88483443-88483465 CGGATTTTAGGAAATTTATCGGG - Intronic
1071973146 10:90928647-90928669 CAGAATGTAGGACATTCAACAGG + Intergenic
1072529665 10:96307039-96307061 CATCAGATAGGCCATTTATCAGG - Intronic
1072939847 10:99751887-99751909 CAGAAAGTAGGACATTTTACAGG - Intronic
1073728633 10:106265452-106265474 CAAGATATAGCACATTTCTCAGG + Intergenic
1074243511 10:111663600-111663622 CAGAATACAGGGCATATATGAGG + Intergenic
1075338280 10:121624617-121624639 TAGAATAAAGGACAACTATCAGG + Intergenic
1076212262 10:128658154-128658176 CAAAATTAAGGACATTTTTCTGG - Intergenic
1076362628 10:129900262-129900284 CAGATTTTAGCACATTTACCAGG - Intronic
1077732266 11:4744562-4744584 CAGAATAGAGGATATTTATGAGG + Intronic
1080250966 11:30233430-30233452 TAGCATATAGGTCATTTATGAGG + Intronic
1081067005 11:38555415-38555437 CACATTATAGAACATTTAACAGG + Intergenic
1081138910 11:39473743-39473765 TATAATATATGACATTTTTCTGG - Intergenic
1084196909 11:67528132-67528154 AAGAATATAGGACCTTTGTTGGG - Intergenic
1085432930 11:76471339-76471361 CAGAATAAAGGAGACTTATCAGG - Intronic
1091946721 12:4551558-4551580 CAGAATTTAGGACATTCTACAGG + Intronic
1092600547 12:10058066-10058088 CAAAATATAGCACCTTTATTGGG - Intronic
1101261646 12:103038055-103038077 CTGAATTTAGGACATCTCTCTGG + Intergenic
1101808490 12:108086917-108086939 CAGAGGACAGGGCATTTATCTGG - Intergenic
1103460049 12:121096401-121096423 CAGAATAAAGTATTTTTATCAGG + Intergenic
1109849940 13:68049486-68049508 AAGAGTATAGGACTTTAATCTGG + Intergenic
1110206383 13:72919167-72919189 CAGAAAATAGAACATCTATATGG + Intronic
1110555934 13:76858890-76858912 CAGAATATAGAACATGGAACAGG - Intergenic
1111914875 13:94350471-94350493 CAGCATATAGGACAATTTTAAGG + Intronic
1112032201 13:95467573-95467595 CAGAGTATAGGACATTTTATAGG - Intronic
1112605290 13:100898558-100898580 CAAAATATAGGACATATACTAGG + Intergenic
1116321038 14:43463285-43463307 AAGAGTCCAGGACATTTATCTGG - Intergenic
1116357440 14:43946998-43947020 CAGATTATACAACATTTGTCAGG + Intergenic
1116922038 14:50588975-50588997 CACAATCTAGAACATTTAGCAGG - Intronic
1119295300 14:73528005-73528027 CAGGCTAAAGGGCATTTATCTGG - Intronic
1120481247 14:85052736-85052758 AAGAATATAAGCCAGTTATCTGG + Intergenic
1123928187 15:25139541-25139563 CAGAATATAGTAATTTTATAAGG - Intergenic
1125511121 15:40292926-40292948 CAGAATTTAGGGCATTGATGGGG + Exonic
1129624037 15:77178027-77178049 AAGAATATAGCAAATTTATAAGG + Intronic
1133143443 16:3765277-3765299 CAGAATAAAAGACATGTACCAGG - Intronic
1135389488 16:22077929-22077951 CATAATAAAGTACATTTTTCAGG - Intronic
1138748167 16:59388055-59388077 CATAATATAAAACATTTTTCAGG + Intergenic
1138867202 16:60836424-60836446 CAGTATATAGGATATTTTTATGG - Intergenic
1141514068 16:84531437-84531459 CAGAAAATAGGAAAATTAGCTGG - Intronic
1151415453 17:73959476-73959498 TACAATATAGGACATTGATGGGG + Intergenic
1155044443 18:22091689-22091711 CAGAATTTTGGACAATAATCAGG + Intronic
1158317965 18:56232654-56232676 GAGAATTTAAGACATTTATGTGG + Intergenic
1158913467 18:62094368-62094390 CAGAATTTAGTACATATTTCTGG + Intronic
1159385789 18:67724184-67724206 CTCAAAATAAGACATTTATCTGG - Intergenic
1159532089 18:69667666-69667688 CAGCATATTGCACATTTTTCTGG + Intronic
1159934146 18:74348245-74348267 CAGAATATGGGACATTCTCCAGG - Intronic
1159967312 18:74607831-74607853 AATAACATAGGTCATTTATCTGG + Intronic
1160101807 18:75927382-75927404 CATAAAATAGAACATTCATCAGG + Intergenic
1161902949 19:7133098-7133120 CAGAAAATAGAACAATTAGCCGG + Intronic
1166530762 19:43542051-43542073 CAAAAAATAGAAAATTTATCAGG + Intergenic
1168506952 19:56943883-56943905 CAGAATTTAGCTCATTAATCAGG - Intergenic
924993073 2:331204-331226 CATAATGTGGGAAATTTATCAGG + Intergenic
926563301 2:14441336-14441358 CAGAATAGAAAACATTTCTCTGG - Intergenic
927589891 2:24345909-24345931 TAAAATATAGGACAATTTTCTGG - Intronic
928070661 2:28212076-28212098 TAGAATATAGGACATTCTGCTGG - Intronic
928687429 2:33763216-33763238 CAGTGTATAGGAAGTTTATCAGG + Intergenic
929345779 2:40882933-40882955 CAGAATATAGGACATTATTGAGG + Intergenic
929741840 2:44610790-44610812 CAGAATATTGTACATATTTCAGG + Intronic
930595632 2:53384720-53384742 CAGAATATAGGTAAAGTATCTGG - Intergenic
930665945 2:54098461-54098483 CAGAATATAGGACATTCCATGGG - Intronic
931142914 2:59483453-59483475 CAGAACAAAGAACATTTACCTGG + Intergenic
931306343 2:61032878-61032900 CAGAAAATATGAGATTTATTTGG + Intronic
931909469 2:66881627-66881649 TAGAAGAGGGGACATTTATCAGG + Intergenic
932723485 2:74157637-74157659 CAAATTATAGGACATTCATCTGG + Intronic
933316526 2:80721801-80721823 CAGAATACAGGACATACATATGG - Intergenic
934980520 2:98836062-98836084 CAGAATATGGGACATTCTGCAGG + Intronic
938881613 2:135595217-135595239 CTAAATATAGGAAATATATCTGG - Intronic
940485787 2:154293869-154293891 CTAAATATATGACATTTATCTGG + Intronic
940489278 2:154336903-154336925 CAGAATATTAGACTTTTTTCTGG + Intronic
942841603 2:180368412-180368434 AATATTATAGGACATTTATTAGG + Intergenic
943486859 2:188495897-188495919 TAGAATATAGCACATTTATTAGG + Intronic
943603683 2:189950995-189951017 CAGAATATGGGGAATTTTTCTGG + Intronic
944127806 2:196314131-196314153 CTGAATAGAGCACATCTATCTGG + Intronic
944659224 2:201906922-201906944 CAAAATGTAGGTCATTTAACAGG + Intergenic
945894830 2:215470144-215470166 CAGAACACACAACATTTATCAGG + Intergenic
946377840 2:219324472-219324494 CAGAATCTAAGCAATTTATCTGG - Intergenic
946542885 2:220705109-220705131 AAGAATAAAGGACATATGTCTGG - Intergenic
947061169 2:226167850-226167872 CAGATTTAAGGACATTTTTCTGG + Intergenic
948324345 2:237100968-237100990 CAGAATGTGGGAAATTTAACAGG + Intergenic
1171888597 20:30684248-30684270 CAGAATATAGAAATTTTATTAGG - Intergenic
1181903823 22:26177388-26177410 CACAAGATAGGCCATTCATCGGG + Intronic
1183030559 22:35100985-35101007 CAGAATATAGGACAGTCAGCAGG + Intergenic
1185096827 22:48812454-48812476 TAAAGTATATGACATTTATCAGG + Intronic
950898582 3:16475847-16475869 TAGGATATAGAATATTTATCTGG - Intronic
951281469 3:20755132-20755154 CAGAAAATAGGTCACTTCTCAGG + Intergenic
953057763 3:39401808-39401830 CAGAAAATGGGACATTTTACAGG - Intergenic
953601792 3:44373194-44373216 CACAAAATGGGAGATTTATCAGG + Intronic
954570188 3:51634230-51634252 CAGAACACAGGAAATTTCTCAGG - Intronic
954991884 3:54848424-54848446 CAGAATATGGGGCATTTGTTTGG - Intronic
956159164 3:66330377-66330399 CAGAATTTTGCACAATTATCAGG + Intronic
956639337 3:71400790-71400812 CACAATGTAGGTCATTGATCTGG - Intronic
957219543 3:77364174-77364196 CAGAAAATAAGACATATAGCAGG - Intronic
958514071 3:95089889-95089911 TAAAATATAGGACATTTAGTTGG + Intergenic
958613205 3:96454103-96454125 CAAAAAATAGGAAAATTATCTGG + Intergenic
958707931 3:97679512-97679534 CATATTATAGTACATTAATCAGG - Intronic
959762752 3:109987599-109987621 AAGAATATAGGATTTTTATTTGG - Intergenic
960219806 3:115092890-115092912 AAGAATAACGGACATTTATGTGG - Intronic
961907779 3:130280421-130280443 GAGCATGTAGGACATTTATATGG - Intergenic
964170025 3:153758754-153758776 CAGAAATTAAGACATTTAACAGG - Intergenic
967401345 3:189065602-189065624 CACAATATCAAACATTTATCAGG + Intronic
967755294 3:193161758-193161780 CAGAATCTAGAACATTCATTGGG + Intergenic
972008594 4:34144297-34144319 CAGAATATATGACATAAATAAGG + Intergenic
973115858 4:46458080-46458102 CAGCATATGGAACATTTTTCAGG + Intronic
974669517 4:65011265-65011287 CATTATGTAGGACATATATCAGG - Intergenic
974891036 4:67882773-67882795 AAGAACATAGAACATTAATCAGG - Intronic
976593969 4:86876715-86876737 CAGAATTTAGGAAAGTTCTCTGG + Intronic
976657046 4:87499502-87499524 CAGAAGAAAGGAAATTTACCGGG + Exonic
983053852 4:163079483-163079505 TAGAATATAGGACAATCAGCTGG - Intergenic
983863026 4:172731970-172731992 CTGAATATAGAACATTTTCCAGG - Intronic
984794653 4:183647931-183647953 CAGAAGAAAGGACATTTAAAAGG + Intronic
987917776 5:24238108-24238130 CAGAATAAAGGAAATCTTTCAGG - Intergenic
988431913 5:31128962-31128984 AAGAATAGAGGACATTCATCTGG - Intergenic
989497665 5:42127696-42127718 CAGTATTTAATACATTTATCTGG + Intergenic
990311785 5:54547251-54547273 GAGAAGAAAGGACCTTTATCTGG + Intergenic
991309847 5:65225883-65225905 CAGAATAAAGTACATTTGTATGG + Intronic
991620637 5:68541696-68541718 CAGGATACAGGTCCTTTATCAGG - Intergenic
993210076 5:84938066-84938088 CAACATAAAGTACATTTATCAGG - Intergenic
993308314 5:86296718-86296740 CAGAATGTAGAACATTGAACAGG + Intergenic
995286566 5:110395696-110395718 CAGAATATATAATATTTAGCTGG + Intronic
998621862 5:143803073-143803095 CAGGATATAGGACATTACTGGGG - Intergenic
998628238 5:143869914-143869936 CAGAATGTAGGACACTGACCTGG + Intergenic
999018324 5:148133961-148133983 CTGAGTAATGGACATTTATCTGG + Intronic
1000343958 5:160298842-160298864 CAGAATATAGGACATTTATCAGG + Intronic
1000894392 5:166837964-166837986 CTCAATATAAGACATATATCTGG + Intergenic
1003295925 6:4828210-4828232 CTGGATATAGGACTTTTAACAGG + Intronic
1003939143 6:11006875-11006897 CAGAAGTCAGGACCTTTATCTGG - Intronic
1008105566 6:47437675-47437697 AAGAATGAAGGACATTTATACGG - Intergenic
1008501497 6:52187819-52187841 AAGAATATAGCATTTTTATCTGG - Intronic
1008805430 6:55421360-55421382 AAGAATATTGGGCATTAATCTGG - Intergenic
1011061457 6:83274658-83274680 CAGAGTATAAGACATATATTGGG + Intronic
1011733716 6:90292847-90292869 CTGAATATTGGATATTTATGTGG - Intronic
1014402547 6:121008730-121008752 CAGAATATTATACATTTATGTGG + Intergenic
1014714047 6:124842901-124842923 CAGAATACAGGAAATATACCAGG - Intergenic
1014967826 6:127778269-127778291 CAGAATATAGGAAATGAATTTGG + Intronic
1018778183 6:167038020-167038042 CAGAATATAGAACATACAGCTGG - Intronic
1020178336 7:5900632-5900654 CAGAATTTAGGAAAGTTCTCTGG + Intronic
1020304590 7:6824367-6824389 CAGAATTTAGGAAAGTTCTCTGG - Intronic
1020659692 7:10967134-10967156 AAGAATTTAGGATATTTATTGGG - Intergenic
1021092826 7:16502848-16502870 CAGAAGATAGGACATTATACAGG + Intronic
1023301672 7:38779434-38779456 CAAAATAATGGCCATTTATCTGG + Intronic
1024663059 7:51518014-51518036 CAGAATTTCGGACATATATGAGG + Intergenic
1024925903 7:54615567-54615589 CAGCAGATAGGAAATGTATCTGG + Intergenic
1028002290 7:85514423-85514445 CAGAATATATCACATTTAGCAGG - Intergenic
1028087126 7:86649844-86649866 CAAAATATAGGACATGCATTGGG + Intronic
1028711367 7:93912863-93912885 AATAATAGAGGACATTTATTAGG - Intergenic
1030661277 7:112221849-112221871 CACAATAAAGGCCATTTATCAGG - Intronic
1032867841 7:135946270-135946292 GAGTTTATAGGACACTTATCTGG - Intronic
1038856304 8:31336791-31336813 CAGAAAAGAAGACATTTATATGG + Intergenic
1040486472 8:47877124-47877146 CAGAATATAAGACATTATACAGG + Intronic
1040922094 8:52632447-52632469 CAGGATATAGACCATTTGTCTGG - Intronic
1042344233 8:67711379-67711401 CAGAAAATATCAGATTTATCAGG + Intronic
1042514393 8:69644362-69644384 CTGAATGCAGGACATTTATATGG + Intronic
1042636210 8:70878381-70878403 CTGAATATAGCACATTGATGGGG - Intergenic
1043187127 8:77166895-77166917 CAGAATTTTGGACATTTTTAAGG - Intergenic
1043551934 8:81384097-81384119 CAGGATATAGAACATTTCCCTGG - Intergenic
1043609459 8:82044517-82044539 CAGAAGATAGTACATTTCTTTGG + Intergenic
1044608088 8:94064394-94064416 CAGATTCTAGGACATTAATTTGG - Intergenic
1045483431 8:102611226-102611248 CATAATATTGGGCATTAATCAGG + Intergenic
1045700208 8:104857421-104857443 CAGAGTAGAGGAAATTTATTGGG + Intronic
1046171477 8:110513603-110513625 CAGAAGATAGAACAATTATCTGG + Intergenic
1046370627 8:113301324-113301346 GAGAATATAGAAAATTTATATGG + Intronic
1046562845 8:115861740-115861762 CAGAATGTAGGAAAATTTTCAGG + Intergenic
1048646044 8:136420933-136420955 TACAATATATGACATTTATGTGG - Intergenic
1050385919 9:5090889-5090911 CAGAATATGGGACTTTCACCAGG - Exonic
1050686830 9:8180415-8180437 CAGAAAATTTGACATTTAGCTGG + Intergenic
1050864864 9:10486072-10486094 CTGGATATTGGACCTTTATCAGG + Intronic
1050871062 9:10570723-10570745 CCAAATCTAGGACATTTATATGG + Intronic
1051442205 9:17097481-17097503 CAAACTTTAGGACATTTATTAGG - Intergenic
1051807852 9:21016032-21016054 CAGAAATTAGGACATCTATTAGG + Intronic
1051947203 9:22583241-22583263 CGGAATAAATGACATTTCTCTGG - Intergenic
1052116496 9:24654151-24654173 CTGGATATAAGCCATTTATCAGG + Intergenic
1052139688 9:24964447-24964469 AAGAATATAGATGATTTATCAGG + Intergenic
1053113350 9:35480909-35480931 CAGCATAAAGGACATTGAACTGG - Intergenic
1053910229 9:42892372-42892394 CAGAATATAGAAATTTTATTAGG + Intergenic
1055569890 9:77605958-77605980 CAGAATATATGAAACTTATCAGG - Intronic
1056419721 9:86412199-86412221 CAAAAAATAGAACATTTACCTGG + Intergenic
1056909193 9:90682705-90682727 CAGAATGTAGGAAATCTATAAGG + Intergenic
1058928917 9:109699058-109699080 CAGCACATAGGACATTTTTATGG + Intronic
1061729074 9:132599446-132599468 AAGGATATAGGAAATGTATCAGG + Intronic
1188096086 X:26024048-26024070 CAGAATATAGCAGATTAATAAGG + Intergenic
1188361013 X:29253798-29253820 AAGAAACTAGGACCTTTATCAGG + Intronic
1188942336 X:36255281-36255303 TAGAATGCAGGACATTTATTAGG + Intronic
1189403027 X:40690208-40690230 CAGATAAGAGGACATTCATCAGG + Intronic
1190625135 X:52330106-52330128 CAGAAAATAGGAGATTTCTTAGG - Intergenic
1191930944 X:66372077-66372099 CACAAAATAAGACATTTATATGG - Intergenic
1193756978 X:85420496-85420518 CAAAATATACCACATTTCTCTGG - Intergenic
1194015767 X:88618762-88618784 AACAATATAGGACATTGCTCTGG + Intergenic
1194521926 X:94930541-94930563 CAGAGTATAGGTGAATTATCTGG + Intergenic
1197505384 X:127296279-127296301 CAGAACAAACAACATTTATCAGG + Intergenic
1198246257 X:134834970-134834992 CAGAATGTGGGACATTTTACAGG - Intronic
1201858786 Y:18572872-18572894 CAGAAAAGAGGCCATTTTTCTGG - Intronic
1201874535 Y:18747509-18747531 CAGAAAAGAGGCCATTTTTCTGG + Intronic
1202024004 Y:20501249-20501271 CAGAATCTGGGAGACTTATCTGG + Intergenic