ID: 1000344628

View in Genome Browser
Species Human (GRCh38)
Location 5:160304469-160304491
Sequence TCATCTCCAGGGGGTCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000344617_1000344628 2 Left 1000344617 5:160304444-160304466 CCTTATTTTATGAACCCCCACAC No data
Right 1000344628 5:160304469-160304491 TCATCTCCAGGGGGTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000344628 Original CRISPR TCATCTCCAGGGGGTCATGA GGG Intronic