ID: 1000347652

View in Genome Browser
Species Human (GRCh38)
Location 5:160328251-160328273
Sequence TTTTAAACACAGGAGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000347648_1000347652 2 Left 1000347648 5:160328226-160328248 CCATGGATGAGAAGTCATGGGAA 0: 1
1: 1
2: 0
3: 12
4: 193
Right 1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG 0: 1
1: 0
2: 2
3: 39
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000347652 Original CRISPR TTTTAAACACAGGAGGAACA GGG Intronic
900886690 1:5420260-5420282 TATTAAGCACAGGAAGAACTTGG - Intergenic
900964721 1:5949981-5950003 TTTTAAACACAGAAGAAAAATGG + Intronic
902747896 1:18485282-18485304 TTCCAAGCCCAGGAGGAACAAGG + Exonic
902889400 1:19431001-19431023 TTTAAAACACAGAATCAACAGGG + Intronic
902892690 1:19455851-19455873 TTATATACACAGGAAAAACAAGG + Intronic
903031642 1:20467917-20467939 TTTTAGACACAGAAGCATCAAGG + Intergenic
905472378 1:38203234-38203256 TTCAAAACACAGGAGGAGCTAGG + Intergenic
905846521 1:41238440-41238462 TTTTAAACACAAGAGTGAGAAGG - Intronic
905853229 1:41289773-41289795 TTTCAAAAACAGAAGCAACAGGG + Intergenic
907119631 1:51996933-51996955 TTTTAAGCAATGGAGTAACATGG + Intergenic
907130278 1:52091577-52091599 TTTTAAACACAGAAAAAATATGG - Intergenic
907775949 1:57515186-57515208 TTTTTAACCCAGGACTAACAAGG - Intronic
908103990 1:60822146-60822168 TTTTGAGCAGAGGAGTAACATGG + Intergenic
909016890 1:70389683-70389705 TTTTAATCACAGGAGTGAGAGGG + Intergenic
909679404 1:78275158-78275180 ATTTAAACATAGAAGGGACAGGG - Intergenic
909734908 1:78946110-78946132 TTTAAAACACTGGAGAAATAAGG + Intronic
909953053 1:81742989-81743011 TCTTAAAGACAAGAGGGACAGGG + Intronic
910052942 1:82997531-82997553 GATTACACAGAGGAGGAACAAGG + Intergenic
910761196 1:90733194-90733216 TTTTAATCAAAGGAGGTACAGGG + Intergenic
912092925 1:106104319-106104341 TTTTTAACACAGGAAGCAAAGGG - Intergenic
913977130 1:143469236-143469258 TTTTAAAAACAGGAATAACTAGG + Intergenic
914071533 1:144294863-144294885 TTTTAAAAACAGGAATAACTAGG + Intergenic
914107622 1:144671493-144671515 TTTTAAAAACAGGAATAACTAGG - Intergenic
915030600 1:152877641-152877663 TTTTAAACAGGGGAGAAACTGGG - Intergenic
915256268 1:154632671-154632693 TTTTAAAGACAAGAAAAACATGG - Intergenic
915302689 1:154960501-154960523 TTTTAAAAACAGGCAGAACTAGG + Intronic
915457418 1:156050160-156050182 TTTTGAACACTGGAGGTACAGGG - Intronic
915729926 1:158046026-158046048 TTTTGAGCACAGGAGTGACATGG + Intronic
916306770 1:163344481-163344503 TTTTAAACATAGCAGTACCAAGG + Intronic
916339761 1:163718815-163718837 TTTTAGATACAGGGGGTACATGG - Intergenic
916368622 1:164062392-164062414 TTTTAAGCAGAGGAGTGACATGG - Intergenic
917732088 1:177884781-177884803 TTTCAACCAGAGGAGGCACAGGG + Intergenic
920388885 1:205586547-205586569 AGGTAAACACAGGAGGACCAGGG - Intronic
920896614 1:210057226-210057248 TTTTAAACAATGGGAGAACAAGG - Intronic
920923353 1:210317564-210317586 TTTTAACCACATGAGAAGCATGG + Intergenic
921223530 1:212993590-212993612 TTTTGTAGACAGTAGGAACAAGG - Exonic
921877412 1:220213969-220213991 TTTTACCCACAGGAAGAAGAAGG - Exonic
923171280 1:231420380-231420402 GTTTCAAAACAGTAGGAACAGGG + Intronic
923190735 1:231618021-231618043 TGTGTAACACATGAGGAACATGG + Intronic
923441004 1:234020420-234020442 TTTTAATGTCAGGAAGAACAAGG - Intronic
924513580 1:244748365-244748387 TTTTAAAGGCAAAAGGAACAAGG + Intergenic
1064095951 10:12424631-12424653 TTTTAAACAGAGGAATAACATGG - Intronic
1064451121 10:15442828-15442850 TTTTTAAAACAGGTGGAGCATGG - Intergenic
1065919405 10:30378927-30378949 TTTTAAACACTTGTGAAACAGGG - Intergenic
1066216696 10:33295262-33295284 TTGGGAACACAGGAGTAACATGG + Intronic
1067842904 10:49696175-49696197 TTTTAGATACAGGGGGTACATGG + Intronic
1068008934 10:51423411-51423433 TTTTGGAAAAAGGAGGAACAAGG - Intronic
1068310731 10:55271229-55271251 TTTTAGAAACAGGAGGTTCATGG - Intronic
1068691889 10:59924975-59924997 TTAAAAACACAGGAGGAAAGAGG + Intergenic
1070469677 10:76766469-76766491 TTCTTCACACAGGATGAACACGG - Intergenic
1070726004 10:78791125-78791147 TTTCAAACAGAGGGGAAACATGG - Intergenic
1071890830 10:90004858-90004880 TTTTAAGCAGAGGAATAACATGG + Intergenic
1071944464 10:90627003-90627025 TTTTAAAAACAGGAAGAAATTGG + Intergenic
1071988535 10:91076576-91076598 TGTTACACATAGGAGGAACCTGG + Intergenic
1073413770 10:103364550-103364572 TTTTAAACACAGGGTTAACCAGG + Intergenic
1073497255 10:103904212-103904234 TGTAAAACACAGGAAAAACAAGG + Intronic
1073525872 10:104181481-104181503 TTCTGAACACAGGATTAACAAGG - Intronic
1073540397 10:104312853-104312875 GCTTAAACCCTGGAGGAACACGG + Exonic
1077238887 11:1500370-1500392 CTTTAAACACAGGCGGTTCACGG + Intronic
1079891809 11:26065218-26065240 TTTTAAACATTTGAGAAACAAGG + Intergenic
1080894820 11:36440342-36440364 CTTTAAACACAGGAGGTACTAGG + Intronic
1083058937 11:59849483-59849505 TATTAGGCACAGGAGAAACAAGG - Intergenic
1084039977 11:66536984-66537006 TTTTAATGACAGGAGGAACTTGG - Intronic
1085402328 11:76242356-76242378 TTTTACAGACAGGAAGACCAAGG - Intergenic
1085742146 11:79086531-79086553 TTTTAAAAATAAGAGGAACTGGG + Intronic
1086797680 11:91128485-91128507 ATTTAAAAACAGGAGGCACCGGG + Intergenic
1086848315 11:91779067-91779089 TTTTAAGCAGAGGAGTGACATGG - Intergenic
1087725747 11:101714167-101714189 TTTTAGATACAGGGGGTACATGG - Intronic
1087767585 11:102173011-102173033 TTTTGAACAGAGGAGTGACATGG + Intronic
1088109947 11:106249652-106249674 TTTAAAGCACAGAAGGACCATGG - Intergenic
1088440119 11:109861030-109861052 TTTTAAACACGGGAGGTTCTTGG - Intergenic
1088977272 11:114826983-114827005 TTTTAGCCATAGGAAGAACATGG - Intergenic
1089059297 11:115613212-115613234 TTTTGAACAGAGGAGTGACATGG - Intergenic
1089087635 11:115836750-115836772 TTTTAAACACAGAAGCCAGAAGG - Intergenic
1089568202 11:119383802-119383824 TTTTGAGCAGAGGAGGGACACGG + Intergenic
1089814568 11:121160891-121160913 TTTTAAAAACAGAAGTTACAAGG + Intronic
1090729785 11:129560018-129560040 TTTTAAAGACAGGAGGCAGTTGG - Intergenic
1090761431 11:129840089-129840111 TTTTAGTTACAGGAGGAATAAGG - Intronic
1090991035 11:131817060-131817082 TTTAAAACCCAGGGGGCACATGG + Intronic
1092540448 12:9417189-9417211 ACTTAAACACAGGAAGAAAAAGG - Intergenic
1092559448 12:9595528-9595550 TATTAAACAAAGAAGGCACACGG + Intronic
1093519395 12:20030630-20030652 TTTCCATCTCAGGAGGAACATGG - Intergenic
1094512598 12:31105290-31105312 ACTTAAACACAGGAAGAAAAAGG + Intergenic
1095652005 12:44622289-44622311 ATGAAAACACAGGAGCAACAAGG - Intronic
1097899593 12:64859413-64859435 TTTTAAGGAGAGGAGGAAAATGG + Intronic
1098941582 12:76542729-76542751 TTTTAAACAAAGGAGTGAAATGG - Intronic
1098986507 12:77018188-77018210 TTTTAATCACAGGGGCAACAAGG - Intergenic
1099294051 12:80807951-80807973 TTTTAAGCACAGGAGAGACATGG - Intronic
1099520143 12:83650260-83650282 GTTTAAACTCAGGAGGAAATAGG - Intergenic
1100590295 12:96021477-96021499 TTTAAAAGTCAGGAGGAAAAAGG - Intronic
1100875399 12:98956422-98956444 TTTTAAGCAGAAGAGTAACATGG - Intronic
1101961046 12:109250367-109250389 TTTTAAAAACCGGGGGAAGAGGG - Intronic
1102209264 12:111112779-111112801 TATAAAACACAGGAGAAGCAAGG - Intronic
1102248691 12:111371063-111371085 TTTTGAGCAGAGGAGGGACATGG + Intergenic
1102829879 12:115988184-115988206 TTTGAAACACAGGATGATTAAGG + Intronic
1103241228 12:119414858-119414880 TTTTAAATGCAGGAAGACCAGGG + Intronic
1103443786 12:120981030-120981052 TTATAAACTCTGCAGGAACAAGG - Intronic
1104066042 12:125306773-125306795 TTTTGAGCAGAGGAAGAACATGG - Intronic
1104212366 12:126701521-126701543 TTTTAAGCACAGGAGCGACCTGG - Intergenic
1104366846 12:128185850-128185872 TTTTAGATTCAGGAGGTACATGG + Intergenic
1105503982 13:20994386-20994408 TTTTAAACACTGAAGGAAATGGG + Intronic
1106022692 13:25930233-25930255 TTTGAAAGAGAGAAGGAACATGG - Intronic
1106178684 13:27352500-27352522 TTCTATGCACAGGAGGAACCTGG - Intergenic
1106677638 13:31978036-31978058 TGGAAAACACAGGTGGAACATGG - Intergenic
1108106478 13:47016136-47016158 TTTTGACCACAGGAGGCTCAGGG - Intergenic
1109691190 13:65892019-65892041 TAATAAACACAGGAGGAAAGAGG + Intergenic
1109826756 13:67731431-67731453 TTTTAAATACAGGAGTACAAAGG - Intergenic
1110022517 13:70492723-70492745 ATTTATTCACAGGAGAAACAAGG - Intergenic
1111703156 13:91715927-91715949 TTTTAAAAACAAGATGAGCATGG - Intronic
1111870871 13:93830581-93830603 TTTTAAAAACAGAATAAACAAGG - Intronic
1111880133 13:93945555-93945577 TTTGCAACTCAGGAGGAACCAGG - Intronic
1112528484 13:100176784-100176806 GTTTTAACAGAGGAGCAACATGG + Intronic
1112669541 13:101618751-101618773 TTCTCCATACAGGAGGAACATGG + Intronic
1112845578 13:103638849-103638871 TTTGAAAGACAGAAGGAAAATGG - Intergenic
1113256014 13:108506075-108506097 TTTTAAAAACAGAAGGTATAAGG + Intergenic
1115056181 14:29130465-29130487 TTTTTAAAATAGGAGCAACAAGG + Intergenic
1117474910 14:56084275-56084297 TCTTAAAGACAGGAGGAAATGGG - Intergenic
1118231444 14:63954164-63954186 TTTTAAGCAGAGGAGTGACAAGG + Intronic
1119081953 14:71703154-71703176 TTTTCAACACAGGAGCCTCAGGG + Intronic
1119137199 14:72231954-72231976 TTTTGAACACAGAAGTGACAAGG + Intronic
1119711945 14:76828774-76828796 TTTTCAACAGAAGAGGAACTGGG + Intronic
1120125025 14:80731576-80731598 TTTTAAATACAGGAACAACAAGG + Intronic
1120318410 14:82927647-82927669 ATGTAAAAACAGGAGGGACATGG - Intergenic
1120566863 14:86070693-86070715 TTTAAAACACATGGGGAAAAAGG + Intergenic
1121611079 14:95280411-95280433 TTTTAAATACAGGAAAAAGAAGG + Intronic
1121763238 14:96463392-96463414 TTTTTAACACAGGATGAAACAGG - Intronic
1122051175 14:99061164-99061186 TCTATAACACAGCAGGAACAGGG - Intergenic
1122487498 14:102090852-102090874 TTTCAAATAGAGGAGGAAAATGG - Intronic
1123817622 15:23995860-23995882 TTTCAAACACAGAAGACACAAGG + Intergenic
1124591648 15:31059115-31059137 TATCAAATCCAGGAGGAACAGGG + Intronic
1124809336 15:32918919-32918941 TTTTAGACACAGCAGGAAGGAGG + Intronic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1126461308 15:48917877-48917899 TTTGAAACAAAGGAGAAAGATGG - Intronic
1127894189 15:63280299-63280321 TTTGAAACACAGCTGGAACTTGG + Intronic
1128255510 15:66193393-66193415 TGTTAAGCACAAGAGGTACAAGG + Intronic
1129881921 15:79012517-79012539 TTTTCTTCACAGGAGGACCAGGG - Exonic
1131187453 15:90287168-90287190 TTTTAAACACTTGTGAAACAAGG + Intronic
1131974597 15:97932023-97932045 TTTTAAAAACAAGAGGTGCAAGG + Intergenic
1133360884 16:5172993-5173015 TATTAAACACAGCTGGAAAATGG - Intergenic
1133958065 16:10464455-10464477 TTTTAAAATCAGGAGGAAATGGG + Intronic
1134833390 16:17342033-17342055 TTTTAAACAGAGGAATGACATGG - Intronic
1135072018 16:19360453-19360475 TTTTGAACACAGGGGGAAGTTGG + Intergenic
1137306792 16:47208665-47208687 TTTTTCAAACAGGAGAAACATGG - Intronic
1137329802 16:47481843-47481865 TTTTGAAAACAGGAAGAACTGGG - Intronic
1137850792 16:51740355-51740377 TTGTAAACAGACGGGGAACAAGG - Intergenic
1138161117 16:54755753-54755775 TTTGAAAAACAGGAGGTAGAAGG - Intergenic
1140359211 16:74330528-74330550 TTTGAAACACAGGAGGGGCCAGG + Intergenic
1140579593 16:76213819-76213841 TTTTAGATACAGGAGGTACATGG - Intergenic
1141236140 16:82218986-82219008 TTTTAAACACAAAAGGAAGCCGG - Intergenic
1141450424 16:84096493-84096515 TTTTAAAAAGCGGAGGAAAAAGG + Intronic
1144677392 17:17170687-17170709 TTTTAAAAACTGGAAGAACGTGG - Intronic
1146628839 17:34455603-34455625 TTTTAAGCAAAGAAGGGACATGG + Intergenic
1146857787 17:36268661-36268683 TTTAAAACACAAGTGAAACAAGG - Intronic
1147032195 17:37647880-37647902 TTTTAAGCAGAGAAGCAACATGG - Intergenic
1147076581 17:37993197-37993219 TTTAAAACACAAGTGAAACAAGG - Intronic
1147077222 17:37999862-37999884 TTTAAAACACAAGTGAAACAAGG + Intronic
1147088107 17:38072743-38072765 TTTAAAACACAAGTGAAACAAGG - Intergenic
1147109103 17:38247773-38247795 TTTAAAACACAAGTGAAACAAGG + Intergenic
1147550695 17:41439360-41439382 CTTTCATCACAGGAGGTACAGGG + Intronic
1147962977 17:44178932-44178954 ACTTAAACACAGGAGGAGAAGGG - Exonic
1148261926 17:46192292-46192314 TTTTAAACTAAAGAGGAAGAGGG - Intronic
1148420348 17:47540322-47540344 TTTAAAACACAAGTGAAACAAGG - Intronic
1150241736 17:63639516-63639538 TTATGAACAAAGAAGGAACATGG + Intronic
1150931100 17:69586319-69586341 TTTTAGATTCAGGAGGTACATGG - Intergenic
1151098173 17:71523222-71523244 TTTTAGATACAGGGGGTACATGG - Intergenic
1151263912 17:72939012-72939034 TCTTATACAAAGGAGGAAGATGG - Intronic
1151526842 17:74675971-74675993 TTTAAAACAAAGGAGCAACCTGG + Intronic
1152152896 17:78613981-78614003 TTTTAATCAAATGAGAAACATGG + Intergenic
1152221130 17:79067435-79067457 TTTTGAACAGACGAGTAACATGG + Intergenic
1154029025 18:10734287-10734309 TTTTAAAAGCAGAAGGAACCTGG + Intronic
1155248976 18:23937727-23937749 TTTTAATCTCAGTAGGATCAAGG + Intronic
1155260752 18:24039643-24039665 TTTTAAGCAGAGGAGTGACATGG + Intronic
1155802643 18:30128255-30128277 TATTAAACATAGGAGGAATATGG - Intergenic
1155984149 18:32211872-32211894 TGTTGAAAACAGGAGGAAAATGG - Intronic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1156976126 18:43223469-43223491 TTTTAAAAAAAGCAGGAATAGGG + Intergenic
1157939047 18:51906537-51906559 ATTTAAACACTGGAGGAAAGAGG + Intergenic
1158883984 18:61807795-61807817 TTCTAAACACTGGAGGATAAAGG + Intergenic
1159212922 18:65350975-65350997 TTTTCACAATAGGAGGAACATGG + Intergenic
1159407351 18:68021819-68021841 TTTTTAACTGAGGAGGAAAATGG + Intergenic
1161002085 19:1915631-1915653 TTATAAACACAGCAGGCACTGGG - Intronic
1161005187 19:1932116-1932138 TTTGAAACACAGAAGGGGCAAGG + Intergenic
1162942862 19:14024111-14024133 TTTAAAACACAGCAAAAACAAGG - Intergenic
1163082178 19:14952111-14952133 TTTTAAAAACAGGAGGTTTACGG - Intronic
1163810278 19:19427092-19427114 TCTTAAAGACAGAAGGAAGAAGG + Intronic
1165209107 19:34218316-34218338 TTTTTAAGACAGAAGGATCATGG + Intronic
1165773414 19:38390791-38390813 TTTTGAGCAGAGGAGGGACATGG - Intronic
1166216638 19:41339963-41339985 TTTTAAGCAAGGGAGGAATAAGG + Intronic
925015282 2:519513-519535 TTTTAAACACAGAATGGAGAAGG - Intergenic
925694377 2:6560367-6560389 TTATAAACAAAGCAGGAAAAGGG + Intergenic
926456904 2:13077907-13077929 TTTTAAAATTATGAGGAACAGGG - Intergenic
927410406 2:22818400-22818422 TTGTATACACAGGAAGTACAGGG - Intergenic
928229660 2:29486613-29486635 TTTATAACAAAGGAGCAACATGG + Intronic
928583692 2:32735146-32735168 TCTTAAACACAGGGTGAACTAGG + Intronic
928706233 2:33952664-33952686 TATTGAAGACAGGAGGAAGAAGG - Intergenic
929532016 2:42758720-42758742 TTTTAAATACAGGAGGAGAAGGG - Intergenic
930789495 2:55309420-55309442 TTTTTAAAAAAGGAGAAACATGG - Intronic
931647287 2:64436035-64436057 TTTTAAATACAGGAGAATGAAGG - Intergenic
932838593 2:75060672-75060694 TTTTAAACAGAGAATGAACATGG + Intronic
933793998 2:85905821-85905843 TTAGAAACAGGGGAGGAACATGG - Intergenic
934031475 2:88052030-88052052 TTCTAAACCCACGAGGAACATGG - Intronic
934181832 2:89630214-89630236 TTTTAAAAACAGGAATAACTAGG + Intergenic
934292135 2:91704433-91704455 TTTTAAAAACAGGAATAACTAGG + Intergenic
934864280 2:97792053-97792075 TTTTGAGCACAGGAGTAAAATGG - Intronic
935062284 2:99619200-99619222 CTTTAAACACAGGAGAGAAATGG - Intronic
935108795 2:100072686-100072708 CTTAATACACATGAGGAACAAGG - Intronic
937694778 2:124796484-124796506 TTTTATAAACAGGAGTACCAAGG + Intronic
939083531 2:137688963-137688985 TGTGAAATACAGGAGCAACAGGG + Intergenic
939302443 2:140362215-140362237 TTTTAAGCAGAGGAGGTCCATGG - Intronic
940355043 2:152731571-152731593 TTTTGAACAGAGGAGCAGCAAGG - Intronic
941082917 2:161082519-161082541 TTTTAAAAACAGGAGGAAAGGGG + Intergenic
941781619 2:169451778-169451800 TTTTTAACATAGGATGAGCATGG + Intergenic
943218334 2:185069337-185069359 CTTTAAACACAGGTGGCCCAGGG - Intergenic
943624871 2:190187331-190187353 TCTTAAACACTGGATTAACAGGG - Intronic
944110461 2:196125990-196126012 TTTTAAATTCTGGAGGAACCAGG + Intergenic
944418794 2:199506362-199506384 TTTTAAACACAGTTGTAACATGG - Intergenic
944678117 2:202051314-202051336 TTTGATCCACAGGAGGAAGAAGG - Intergenic
945199861 2:207270737-207270759 ATTTAAACTCAAGAAGAACATGG + Intergenic
945509191 2:210679687-210679709 TCTTGACCACAGGAAGAACAAGG - Intergenic
945649863 2:212543644-212543666 TCTTAAACAAAGAAGAAACAGGG - Intergenic
945986199 2:216355819-216355841 TTTTTAACACAGAAGAAAAAAGG - Intronic
946132533 2:217617975-217617997 TTTCAGACACAGGAGGAGCTGGG + Intronic
946640871 2:221782364-221782386 TTTTAAAAACAGGAGGTAGAAGG + Intergenic
947260283 2:228213972-228213994 TTTTAAAAATAGGAAGAAAAGGG + Intergenic
947511613 2:230759823-230759845 TTTCAAAATCAGTAGGAACAGGG - Intronic
1168797674 20:622402-622424 TTTTGAGCAAAGGAGGGACATGG - Intergenic
1169249632 20:4050427-4050449 TTTCCAGCAGAGGAGGAACATGG - Intergenic
1169369259 20:5015980-5016002 TTTTAAAGACAGGCTGGACATGG + Intergenic
1170049844 20:12129900-12129922 TTTAAAAAATAAGAGGAACAAGG + Intergenic
1171088368 20:22260795-22260817 TTTGAAAGAAAGCAGGAACAAGG - Intergenic
1171155226 20:22865892-22865914 TTCTCAACAGAGGATGAACAGGG + Intergenic
1171497908 20:25570095-25570117 GTTTTAACACAGGAGGCAGAGGG + Intronic
1172115160 20:32569363-32569385 TTTTGAACAGAGAAGGAACATGG + Intronic
1173184531 20:40830529-40830551 TTTTAAGCACAGGAGTGACTTGG + Intergenic
1173401226 20:42727772-42727794 TTTTAAACACAAAAGTAACAAGG - Intronic
1173526281 20:43735321-43735343 TTTTAAAAAAAGGAGGAAGTTGG - Intergenic
1173614435 20:44393587-44393609 TTTTACACACCAGAGGCACAGGG - Intronic
1174288059 20:49485894-49485916 TTTTAAGCAGATGAGAAACATGG - Intergenic
1174551804 20:51367549-51367571 TTCTAATCACAGGAGTAGCATGG + Intergenic
1175413808 20:58788314-58788336 TTTTAGGCAGAGGAGGGACAAGG + Intergenic
1176324262 21:5373214-5373236 TTTGAAGCACATGAGGAATATGG + Intergenic
1176730645 21:10493003-10493025 TTTTAAAAACAGGAATAACTAGG - Intergenic
1177266762 21:18796195-18796217 TTTTACAGATTGGAGGAACAAGG + Intergenic
1178297028 21:31418654-31418676 CTTTAAACACAGGAGTTAGAGGG + Intronic
1178726732 21:35059289-35059311 TTTTAAAAAAAGCAGGAACAAGG - Intronic
1180400730 22:12419894-12419916 TTTGAAGCACATGAGGAATATGG + Intergenic
1182100458 22:27654270-27654292 TGCTAAACACAGGAGTAAGAGGG + Intergenic
1182723399 22:32422926-32422948 TTTTTAACACAGAAGGACAATGG - Intronic
1184947680 22:47815808-47815830 TTTTAAAGGCAGGAGGCACGGGG - Intergenic
950087037 3:10266529-10266551 TTTTACACACAGGAAGAAACTGG - Intronic
950305107 3:11911057-11911079 TTTTACACCCATAAGGAACAGGG + Intergenic
950380806 3:12613350-12613372 TTTCAATCAGAGGAGGAACCTGG - Intronic
950987055 3:17384649-17384671 TTTTTAGGAGAGGAGGAACATGG + Intronic
951057246 3:18161932-18161954 TTTCAAACACAGGAGTAGAAAGG + Intronic
952020093 3:29008298-29008320 TTTTAGATTCAGGAGGTACATGG - Intergenic
952328149 3:32339432-32339454 TTTCAAACACAGCATGAAGATGG - Intronic
952519600 3:34143325-34143347 TTATGAATACAGGAAGAACAAGG - Intergenic
952622309 3:35360619-35360641 TGTAAAACAAAGGAGGAAAATGG - Intergenic
952675116 3:36020183-36020205 TTTAAAACACATAAGCAACAGGG - Intergenic
954893521 3:53955082-53955104 TTTAAATAACAGGAGGAAAATGG + Intergenic
956057417 3:65315072-65315094 TGTTTAACACAGGTGGCACAAGG + Intergenic
956599598 3:71005990-71006012 AATCAAACACAGGAGGAACACGG + Intronic
957361015 3:79157835-79157857 TTTGAAAGACAGGAAGTACATGG + Intronic
958105912 3:89072773-89072795 TATTAAAAACAGTAGGGACAAGG - Intergenic
959112749 3:102141666-102141688 TTTTGAACAGAGGAGAAAAATGG + Intronic
959372395 3:105544068-105544090 TTTTAAACCAAGGAGAAACTTGG + Intronic
960194712 3:114751071-114751093 TTTGACACACAGTAGGAACTTGG - Intronic
960474547 3:118108008-118108030 TTCAACACACAGGAGGAAAAAGG + Intergenic
960598978 3:119436252-119436274 ACTTAAACACAGGAGAAGCAGGG + Intronic
961407820 3:126694504-126694526 TTTTAGATTCAGGAGGTACACGG + Intergenic
962433203 3:135339375-135339397 TATAAAACACATGAGGAAAAGGG - Intergenic
962753835 3:138453397-138453419 CTTTAAACTCAGGAGGCACTTGG + Intronic
963942060 3:151105251-151105273 TTTTAATCACACAAGGAAGAAGG - Intronic
964733770 3:159894818-159894840 TTTTAAACAAAGGAGGGAAAGGG - Intronic
964778193 3:160304329-160304351 TTTTAAAAACAGTAGCAGCATGG + Intronic
967777655 3:193401004-193401026 TTTTAAAACCAGAAGTAACAGGG + Intergenic
968015570 3:195329378-195329400 TTTAAAACACAGAAGGACCAGGG - Intronic
969153275 4:5188374-5188396 TTTCAAACACTTGAGGATCAAGG - Intronic
971060297 4:22960773-22960795 TTTTAAGCACTGGAGAAATAGGG + Intergenic
971588778 4:28440096-28440118 TTTTAATTAAGGGAGGAACAAGG - Intergenic
971603461 4:28625833-28625855 TTCTAAACATAGGAGGTTCAAGG + Intergenic
971760359 4:30757325-30757347 TTTTACACACAGGAGCAACTTGG - Intronic
973342876 4:49024254-49024276 TTTTGAAGACAGCAGGAACTTGG + Intronic
974561635 4:63530095-63530117 TTTTAAAACCAGGAGGCAAACGG + Intergenic
974877531 4:67716883-67716905 TTTTATGCTCAGGATGAACAAGG - Intergenic
975825399 4:78314556-78314578 TTCTAAACACAGTAGAAACACGG - Intronic
977003662 4:91536839-91536861 TTTTTAAGACAGGATGAAAAAGG - Intronic
978588107 4:110294435-110294457 TTTAAAACACAGGGGAAAAAAGG + Intergenic
979025474 4:115568134-115568156 ATTTAAAGACAAGAGAAACAGGG + Intergenic
980379802 4:131997987-131998009 TTTTAAAAAAAGGAGGAAGGAGG + Intergenic
980857546 4:138457460-138457482 TTTTAAATTCAGGAGCATCATGG - Intergenic
981737222 4:147965519-147965541 TTTTAAAAGGAGGAGGAAAAGGG - Intronic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
982243957 4:153330377-153330399 TTTTACACACAGGAGGAATATGG - Intronic
983227995 4:165103287-165103309 TTTTAAAAACTGTAGCAACACGG + Intronic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
984588337 4:181588136-181588158 TTTTGAAGCCAGCAGGAACAGGG + Intergenic
985093630 4:186390065-186390087 TTTTAGAAAAAGGAGGAACATGG - Intergenic
986279511 5:6311977-6311999 TTTTAAACAAAGGAAGGAGAGGG + Intergenic
986742124 5:10713411-10713433 TTTCAAGCCCAGGAGGAGCAGGG + Intronic
987667808 5:20967226-20967248 TTTTAAACACACAGGGAAGAAGG - Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
988171175 5:27658287-27658309 CTTTAACAACAGGAGTAACAGGG - Intergenic
989210655 5:38855817-38855839 TTTTAAGCAGAGGAGTAACGTGG - Intronic
990190561 5:53255454-53255476 TTTAAAACACAGAAAGAAAATGG - Intergenic
990703974 5:58506474-58506496 TTTTAAACATATGTGGAAGAAGG - Intergenic
990996725 5:61739559-61739581 TTTGAAACACGGAAGGAACAGGG + Intronic
991637936 5:68724873-68724895 TTTTATACACATGAGGCTCAGGG + Intergenic
995208333 5:109508020-109508042 TTTCACTTACAGGAGGAACAAGG + Intergenic
996415780 5:123208744-123208766 TTAGAAACACAGGGGTAACAGGG - Intergenic
997863866 5:137443872-137443894 TTTTAAACAACGAAGGGACAGGG - Intronic
998235134 5:140392177-140392199 TTTTAAATAGAGGAGTAACAAGG - Intergenic
998587175 5:143439286-143439308 TATTAGACACCTGAGGAACATGG - Intergenic
998665456 5:144292170-144292192 TTTTAAGCCCAGGAGGGGCAGGG + Intronic
998761856 5:145440878-145440900 TTGTGACCACAGGAGGAACATGG - Intergenic
999402263 5:151274355-151274377 GTTTGAACACAGGAGGCAGAGGG - Intergenic
1000076375 5:157791427-157791449 CTTTGCACAGAGGAGGAACATGG - Intronic
1000347652 5:160328251-160328273 TTTTAAACACAGGAGGAACAGGG + Intronic
1001702207 5:173714972-173714994 TTTTAAGCAGAGGAGAGACAGGG - Intergenic
1002598325 5:180338761-180338783 TTTTTGTCACAGGAGGAAGAAGG - Intronic
1003161083 6:3635414-3635436 CTTTAAGGACAAGAGGAACAAGG - Intergenic
1003534257 6:6962438-6962460 TTTGAAATACAAGAGGAACATGG - Intergenic
1003637831 6:7849972-7849994 TTCTAAACAGAGGAGTAACCTGG - Intronic
1003991251 6:11488624-11488646 TTTTAAACACAGCAGCAAGTTGG - Intergenic
1004529072 6:16436802-16436824 TTTTGATCAGAGGAGGTACAGGG + Intronic
1005583401 6:27253501-27253523 TTTTGAGTACAGGAGGGACAAGG - Intronic
1007603979 6:43103234-43103256 TTTTAAACTCAGAAGGGAGAAGG - Intronic
1007795870 6:44346672-44346694 TTTTAAAAACAGGCTGGACAAGG - Intronic
1008477707 6:51949978-51950000 TTTTAATTAAAGGAAGAACAGGG - Intronic
1009555261 6:65155946-65155968 TTTTTAACAGAAGAGTAACAAGG + Intronic
1010037847 6:71346586-71346608 TTGTAAACATAGGAAGAAGAGGG - Intergenic
1010569313 6:77458829-77458851 CTTAAAATACAGGAGGAACTGGG - Intergenic
1012269676 6:97193530-97193552 TTTATAACACAGTAGTAACAAGG + Intronic
1012493108 6:99804583-99804605 TTTTAAAGATAAGAGAAACAAGG + Intergenic
1014491425 6:122066575-122066597 TTTTAAAAACAGGAGAAAAATGG - Intergenic
1014704938 6:124734423-124734445 TTTTAAGCAAAGGAGAAACATGG - Intronic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1015955427 6:138593180-138593202 TATTAATCACAGGAGGTAGACGG + Intronic
1016104100 6:140140470-140140492 TTTTAAGCACAGTAGGAATTGGG + Intergenic
1016580442 6:145623634-145623656 TTTTAAACACAGGAGTGACAAGG + Intronic
1020686735 7:11305543-11305565 TTTTAAAAACATGAGAAATATGG + Intergenic
1020968631 7:14904427-14904449 AATTAAACAGAGGGGGAACACGG + Intronic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1021716120 7:23464291-23464313 TTTTAAACACAAGACTAATATGG + Intronic
1021746189 7:23743539-23743561 TTCTAAAAACAGAAGGAAAAAGG - Intronic
1021981513 7:26059899-26059921 TTTTAAAAACAGGATCAAGAGGG + Intergenic
1022230000 7:28405493-28405515 GTTTGAACCCAGGAGGATCAAGG - Intronic
1023358276 7:39389737-39389759 TGTTAAACACAGGGGAAAAATGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024894660 7:54243975-54243997 GTATAAACACAGTAGGAATATGG + Intergenic
1025846825 7:65206731-65206753 TTTTAAAAATAGTAGAAACATGG + Intergenic
1026661200 7:72304273-72304295 TTTGAAAGACAGGAAGAACGTGG - Intronic
1027193049 7:76009064-76009086 GTTTAAAAACAGCAGGAAGAGGG - Intronic
1027721354 7:81745772-81745794 TTTTAAAAAGAGTGGGAACATGG - Intronic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030090921 7:105857867-105857889 TCTTAAGCTAAGGAGGAACAAGG - Intronic
1030316694 7:108122693-108122715 TATTAAAGACAGCAGGAGCATGG + Intronic
1031247590 7:119336538-119336560 TTTTAAAGAAAGAAGGAATAAGG + Intergenic
1031345307 7:120658248-120658270 TTGAAAATACAGCAGGAACAGGG - Intronic
1032473749 7:132198449-132198471 CATGCAACACAGGAGGAACAGGG - Intronic
1033595981 7:142857973-142857995 TTTGAAACATAGAAGGAAAATGG + Intronic
1033682405 7:143607703-143607725 TTTTAGACACGGAAGTAACATGG - Intergenic
1033702484 7:143854210-143854232 TTTTAGACACGGAAGTAACATGG + Intronic
1035463519 7:159061317-159061339 TTTTAGACTCAGGGGGCACATGG - Intronic
1035797745 8:2374979-2375001 TTTTAAATTAAGGAGTAACATGG + Intergenic
1036523974 8:9518284-9518306 TTGGAAGCACAGGAGAAACAAGG + Intergenic
1037662361 8:20938928-20938950 ATTTATACACAGGAGGAATTGGG + Intergenic
1037745171 8:21637656-21637678 TTTCAAGCAGAGGAGTAACAGGG - Intergenic
1038187759 8:25291166-25291188 CTTTAAACCCAGGAGGGGCATGG + Intronic
1038402748 8:27297916-27297938 TTTTAAGCAGAGGAGGGGCACGG + Intronic
1038957414 8:32482657-32482679 TCTTCCATACAGGAGGAACAGGG + Intronic
1040034728 8:42859188-42859210 TTTCAAACACAAGAGCATCATGG + Intronic
1040698103 8:50027112-50027134 TTTTAAACACAGAAATAACATGG - Intronic
1041730625 8:61058850-61058872 TTTGAAACACACCAAGAACATGG - Intronic
1042209554 8:66366297-66366319 TTTTAAGCAGAGGAGTAACATGG - Intergenic
1042678925 8:71357248-71357270 TTTTAAACCGAGGAAGAAAATGG + Intronic
1042818481 8:72904355-72904377 TTTTTAACACAGGGGGTAGAAGG + Intronic
1043414797 8:80035834-80035856 TGTCAAACACAAGAGGAACCAGG + Intronic
1044559537 8:93598813-93598835 ATTTAAAGACAGGATTAACAAGG - Intergenic
1044899844 8:96932645-96932667 TTTGAAAGACAGGAGGACCAAGG - Intronic
1045734306 8:105277135-105277157 CTTTAAATACAAGAGGAACATGG - Intronic
1045842775 8:106599033-106599055 TTATAAACACATGAGAAAGAGGG + Intronic
1047119612 8:121886390-121886412 TTTTAGATACAGGGGGTACATGG + Intergenic
1047751693 8:127885897-127885919 TTTTAGACCCAAGAGGAAGATGG - Intergenic
1048227738 8:132605667-132605689 TTTAGAATACAGCAGGAACAGGG + Intronic
1048896073 8:138993609-138993631 GTTGAAATACAGGAGGCACATGG + Intergenic
1050016030 9:1235616-1235638 TTTTAATCACATGAGGAAGAGGG + Intergenic
1050937986 9:11423405-11423427 ATATCATCACAGGAGGAACATGG + Intergenic
1052597731 9:30582088-30582110 TTTTTAAGACAGAAGGAATACGG + Intergenic
1052899012 9:33774192-33774214 TTTTAGTTACAGGAGGAACAAGG - Intronic
1053188015 9:36035817-36035839 TTTTCAAAAAAGGAGGAAAAAGG + Intergenic
1054702387 9:68426242-68426264 TTTTAAATACATGAGGAATTGGG - Intronic
1054703641 9:68439280-68439302 TCTTGAACACAGGAGGGACAAGG + Intronic
1055539029 9:77281514-77281536 TTTTAAATACAGGAAGAATTAGG + Intronic
1056178997 9:84063294-84063316 TCTTAAACAGAGGAGGGATAGGG + Intergenic
1056290235 9:85135717-85135739 TTCTAGACAGAGGGGGAACAGGG + Intergenic
1057903394 9:98966367-98966389 TTCTCCACACAGGAGGACCAGGG + Intronic
1058220719 9:102297395-102297417 TCTTAGACACAAGAGGAAAAGGG + Intergenic
1058937383 9:109781222-109781244 TTTTAAACCCAAGATGCACATGG - Intronic
1059236470 9:112764565-112764587 TTTTAAGCGGGGGAGGAACAGGG + Intronic
1059464274 9:114457521-114457543 TAATAAACATAGAAGGAACATGG + Intronic
1060263881 9:122098806-122098828 TTTTAAACAGAGGACTGACATGG - Intergenic
1061854032 9:133431952-133431974 TTTTAAAATCAGAAGGAAAAAGG - Intronic
1203381771 Un_KI270435v1:56369-56391 TTTGAAGCACATGAGGAATATGG + Intergenic
1187328628 X:18315402-18315424 TTTTAAACAGGGGAATAACATGG + Intronic
1188346438 X:29072278-29072300 TCTTAACCATAGGAGGAAAAAGG + Intronic
1189068136 X:37833808-37833830 TGTTAACCACTGGAGGAACTGGG - Intronic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1190161497 X:48034684-48034706 TTTTAAACACAGGACAGATATGG + Intronic
1192588188 X:72337466-72337488 TTGTAAACAAAGGAGGAGTAAGG - Intronic
1193144255 X:78061208-78061230 TTTTAAGCACTGGAGCCACAAGG - Intergenic
1195573018 X:106417555-106417577 TTTTAGACAGAGGAGTGACATGG + Intergenic
1197169879 X:123420411-123420433 TTCTAAGCACAAAAGGAACAGGG - Intronic
1197343902 X:125308438-125308460 TCCTAAGCACAGGAGGAAAAGGG + Intergenic
1197378112 X:125707194-125707216 TTTTAAACAAGGAAGAAACATGG + Intergenic
1197390480 X:125857574-125857596 TACATAACACAGGAGGAACAGGG - Intergenic
1199440314 X:147860342-147860364 TTGTAAACACAAGAGCAAAAAGG + Intergenic
1199719184 X:150530079-150530101 TTTTTCACACAGGAGGAAGTTGG + Intergenic
1199748092 X:150788349-150788371 TTTTAAACAGAGGAATGACAGGG + Intronic
1200322898 X:155208159-155208181 TTTTAAACAGTGGAGGGAGATGG + Intronic
1201903835 Y:19069464-19069486 TTGTAATCACAAGAGGAAGAGGG + Intergenic