ID: 1000352276

View in Genome Browser
Species Human (GRCh38)
Location 5:160361283-160361305
Sequence CAGTCTGGGCAGAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 321}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000352276_1000352283 2 Left 1000352276 5:160361283-160361305 CCAAGGGCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 31
4: 321
Right 1000352283 5:160361308-160361330 ATGTGAGAGGTGCCAAAAGTGGG 0: 1
1: 0
2: 0
3: 20
4: 160
1000352276_1000352282 1 Left 1000352276 5:160361283-160361305 CCAAGGGCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 31
4: 321
Right 1000352282 5:160361307-160361329 GATGTGAGAGGTGCCAAAAGTGG 0: 1
1: 0
2: 3
3: 30
4: 256
1000352276_1000352286 10 Left 1000352276 5:160361283-160361305 CCAAGGGCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 31
4: 321
Right 1000352286 5:160361316-160361338 GGTGCCAAAAGTGGGGACGTGGG No data
1000352276_1000352285 9 Left 1000352276 5:160361283-160361305 CCAAGGGCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 31
4: 321
Right 1000352285 5:160361315-160361337 AGGTGCCAAAAGTGGGGACGTGG No data
1000352276_1000352284 3 Left 1000352276 5:160361283-160361305 CCAAGGGCCCTCTGCCCAGACTG 0: 1
1: 0
2: 5
3: 31
4: 321
Right 1000352284 5:160361309-160361331 TGTGAGAGGTGCCAAAAGTGGGG 0: 1
1: 0
2: 2
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000352276 Original CRISPR CAGTCTGGGCAGAGGGCCCT TGG (reversed) Intronic
900230660 1:1555409-1555431 CAGCCTGGGCAGTGGCACCTCGG + Intronic
900315224 1:2052918-2052940 AAGTGTGCTCAGAGGGCCCTGGG - Intronic
900534394 1:3169801-3169823 CAGCCAGGGGAGAGGGCCCGAGG - Intronic
900635731 1:3664141-3664163 CAGTCTGGGCACGGGCCCCTGGG + Intronic
901034171 1:6326303-6326325 AATTCAGGGCAGGGGGCCCTGGG - Intronic
902086862 1:13869370-13869392 CACACTGAGCAGATGGCCCTTGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902342317 1:15792095-15792117 CAGGCTGCGCAGGGGACCCTAGG - Intergenic
902791460 1:18771315-18771337 TAGTCTGAGCAGAGTGCCATGGG - Intergenic
902850032 1:19148026-19148048 CAGGCTGGCCAGAAGGCTCTTGG + Exonic
903271345 1:22190334-22190356 CAGCCTTGGCAGCTGGCCCTGGG + Intergenic
903329221 1:22588642-22588664 GAGTCTGGGCACAGAACCCTGGG - Intronic
903775573 1:25791405-25791427 CACACAGGGCAGAGGGCACTCGG - Intergenic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904423384 1:30408319-30408341 CAGCCTGGCCAGATGGCCTTTGG - Intergenic
905269217 1:36775953-36775975 CAGACTGGGGAGAGGGTCCAAGG - Intergenic
905457839 1:38100679-38100701 CAGTCTGGGAAGAGGGGCCTTGG + Intergenic
905485381 1:38292420-38292442 CAGGCTGGGCAGCGGGCCGGTGG - Intergenic
905975062 1:42168567-42168589 CAGACTAGGCAGAGGGGCTTGGG - Intergenic
906150334 1:43583818-43583840 AAGCTTGGGCAGAGGGGCCTGGG - Intronic
908257987 1:62318466-62318488 CGGGCTGGGCAAAGCGCCCTCGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910835903 1:91509851-91509873 CAGTCTGGGCAGTGGCCCTGAGG - Intronic
911668575 1:100583089-100583111 CAGTCTGTTCAGAAGCCCCTGGG - Intergenic
913174468 1:116261599-116261621 CAGTCTGGCCTGAGGGCACAGGG - Intergenic
915091656 1:153430337-153430359 CAGCCTGGACAAAGGTCCCTGGG - Intergenic
915146808 1:153800356-153800378 CAGTCAGGGCAGAGCCTCCTGGG - Intergenic
915299104 1:154941890-154941912 GAGGCTGGGCTGAGGGCACTGGG + Intergenic
915448715 1:155989921-155989943 CAGTGAGGGGAGAGGACCCTGGG - Intronic
915714393 1:157930853-157930875 AAGTCTGGGAAGAAGTCCCTGGG + Intergenic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
916572423 1:166039342-166039364 CTGGCCGGTCAGAGGGCCCTGGG + Intergenic
918354478 1:183693847-183693869 CAGACTGATCAGAGGACCCTTGG + Intronic
920585748 1:207158209-207158231 CATTCTGGGAAGAGGGCCTGGGG + Intergenic
920631709 1:207659189-207659211 CAGGCTGGCCAGAGTTCCCTTGG - Intronic
1063371043 10:5523394-5523416 CAGCCTTGGCAAAGAGCCCTGGG - Intergenic
1063551245 10:7035645-7035667 CAGTCTGTGCACAGAGACCTGGG + Intergenic
1064975815 10:21113626-21113648 CATTCTGGGCAATGGGACCTGGG - Intronic
1065046907 10:21753429-21753451 CACCCTGGGCCCAGGGCCCTGGG - Intergenic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1071191322 10:83104789-83104811 CAGTATGAGCAGAGTGCCTTGGG - Intergenic
1072747233 10:97949346-97949368 CAATCTGTGCAGAGAGTCCTGGG + Intronic
1074549494 10:114429429-114429451 CATTCTGTGCAGTGTGCCCTGGG + Intergenic
1074869870 10:117568061-117568083 AGGGCTGGACAGAGGGCCCTAGG + Intergenic
1074971854 10:118545469-118545491 CAGTGTGGGGAGAGGGTGCTGGG - Intergenic
1075677963 10:124309230-124309252 CACTCTGAGCAGAAGGCTCTGGG + Intergenic
1077029055 11:455455-455477 CTGTCTGTGCTGTGGGCCCTTGG + Intronic
1077223362 11:1427045-1427067 TAGTTTGGGTAGGGGGCCCTGGG - Intronic
1077338077 11:2014274-2014296 CACTCTGGCCTGAGGGCCCGTGG + Intergenic
1077363020 11:2149198-2149220 CAGTTTCGGCAGAGAGCCTTGGG - Exonic
1077440010 11:2563769-2563791 CAGGCAGTGCAAAGGGCCCTGGG - Intronic
1078386811 11:10899613-10899635 AAGTCTGGGCGCTGGGCCCTGGG + Intergenic
1078602574 11:12746842-12746864 CAGGCTGGGCTGAGGGCTGTGGG + Intronic
1080642025 11:34163809-34163831 CACTCTGAGCACAGGACCCTTGG - Intronic
1080772693 11:35356487-35356509 AACCCTGGGCAGAAGGCCCTTGG + Intronic
1081207116 11:40289484-40289506 CTTTCTGGGCATAGGGTCCTCGG + Intronic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1083202888 11:61131088-61131110 CCCTCTGGCCAGAGGGCCCAAGG + Exonic
1083657678 11:64237522-64237544 CAGCGTGGGCAGAGGGGCCTGGG - Exonic
1083948728 11:65941807-65941829 CAGTCGGTGCAAAGGGCCTTAGG + Intergenic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084424296 11:69076351-69076373 CAGTGTGGGCAGGTGGCCTTTGG + Intronic
1084534878 11:69750761-69750783 CTGTCTGCGGAGAGGGCCATGGG - Intergenic
1084617719 11:70247504-70247526 CAGAGTGGGGAGAGGGCCCCTGG - Intergenic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087951093 11:104220938-104220960 CAGTGTTGGAAGAGGGGCCTGGG - Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1089290660 11:117436177-117436199 AAGTCTGGGCAGTGGACCCTGGG + Intronic
1089394763 11:118129348-118129370 AAGGCTGGGGAGAGGGCCCCAGG - Intergenic
1089563430 11:119357334-119357356 AAGTCGGGGCAGGGGGGCCTCGG - Intronic
1089780585 11:120870620-120870642 CAGTCTGGACAAAGGGTACTGGG + Intronic
1091172245 11:133529457-133529479 AAGACAGGGCAGAGGGCCCGTGG - Intronic
1202821061 11_KI270721v1_random:69456-69478 CACTCTGGCCTGAGGGCCCGTGG + Intergenic
1091906954 12:4196926-4196948 CAGCCTGGGTAGAGGCCCCATGG - Intergenic
1092616194 12:10218119-10218141 CAGTAAGGTCAGAGGGCACTAGG - Exonic
1096871317 12:54594127-54594149 CAGGCTTGGCAGAGGGTACTGGG + Intergenic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1101967116 12:109289166-109289188 CAGTCAGGGCAGAAAGCACTTGG + Intronic
1101980925 12:109406258-109406280 CAGTCTGGGCAGATAACCCTGGG + Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1103922333 12:124405448-124405470 GAGCCTGTGCACAGGGCCCTAGG - Intronic
1104758527 12:131283455-131283477 CACACTGGGCAGATGGTCCTGGG - Intergenic
1104822166 12:131683536-131683558 CACACTGGGCAGATGGTCCTGGG + Intergenic
1105240985 13:18609605-18609627 CAGCCTGCGCAGCGGGCACTCGG - Intergenic
1105612195 13:21978156-21978178 CAGGCTGGGCTCAGGCCCCTGGG - Intergenic
1106115210 13:26811847-26811869 CAGCCTGGGAAGAGGGGCCACGG - Intergenic
1108343012 13:49516020-49516042 CATTCTAAGCAGAGGGCCTTGGG - Intronic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1115536714 14:34379927-34379949 CACTCTGCTCACAGGGCCCTTGG - Intronic
1119853016 14:77879470-77879492 CAGTGTGTGCAAAGGGCCCATGG + Intronic
1121266091 14:92603559-92603581 CAGACCGGGCACAGGCCCCTGGG - Intronic
1121310928 14:92934579-92934601 CAGTGTGGGGACAGGGCCCCCGG + Intronic
1121998957 14:98630237-98630259 CAGGGTGGGGAGAGGGCTCTTGG + Intergenic
1122092776 14:99350969-99350991 CTGTCTGGACAGAGGGCCCGTGG + Intergenic
1122094744 14:99362738-99362760 CAGGGTGCGCAGGGGGCCCTGGG + Intergenic
1122924109 14:104891945-104891967 CCATCTGGGCAGAGGGTGCTGGG + Intronic
1123490372 15:20775540-20775562 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1123546873 15:21344627-21344649 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1125727813 15:41877018-41877040 CAGGCTGGGCAGGAGGCCCCTGG - Intronic
1126677225 15:51171111-51171133 CATTCTGGGCAGACAGGCCTGGG + Intergenic
1128532146 15:68461829-68461851 CCATCTGGGCAGAGGACTCTGGG - Intergenic
1129323340 15:74786845-74786867 CATTCAGTGCAGAGGTCCCTTGG + Intronic
1129409255 15:75339811-75339833 CAGGCTGGGCTGGGGTCCCTGGG - Exonic
1129521909 15:76191528-76191550 CAGGCTGGGACGGGGGCCCTGGG + Intronic
1129766655 15:78173806-78173828 CAGTCTGGTCAGAGGTGTCTGGG + Exonic
1130015112 15:80180286-80180308 GAGGCTGAGCTGAGGGCCCTTGG - Intronic
1131112811 15:89776208-89776230 AAGTCTGGGCAGGGGGCCCCTGG - Intronic
1131153081 15:90059216-90059238 CAGCCTGTGCAGAGGCCCCAAGG + Intronic
1131890863 15:96970236-96970258 CAGTGTGCTCAGAGGGGCCTTGG - Intergenic
1132206871 15:99992606-99992628 CAGACAGGGCAGGGGGCCATGGG - Intronic
1132675278 16:1118813-1118835 CAGGCTGGGCAGAGGGGCCTGGG - Intergenic
1132981253 16:2739661-2739683 CAGCCTGGGGTGAGGGGCCTTGG - Intergenic
1133001037 16:2851922-2851944 CAGGCTGGGATGAGGGCCCTGGG + Intergenic
1133317034 16:4891282-4891304 CAGTGTGGGAAGGGGGCCCGTGG + Intronic
1133739901 16:8643519-8643541 CAGTGAGGGCAGGGGGCCCCGGG + Intronic
1134135470 16:11673950-11673972 CAGCTTCTGCAGAGGGCCCTGGG - Intronic
1134691395 16:16192898-16192920 CAGTGAGGGCGGAGGGCCCCAGG + Exonic
1134858790 16:17542505-17542527 CAGTCAGAGGAGAGGGCCCAAGG - Intergenic
1135938896 16:26803909-26803931 GAGGTTGGGCAGAAGGCCCTTGG - Intergenic
1136933143 16:34436470-34436492 CAGTGAGAGGAGAGGGCCCTGGG - Intergenic
1136971429 16:34975344-34975366 CAGTGAGAGGAGAGGGCCCTGGG + Intergenic
1138713670 16:58997613-58997635 CAGTCAGGGCAGAGGGGACTTGG + Intergenic
1139374358 16:66487544-66487566 CTGGCTGGGCAGAGGGTCCCAGG - Intronic
1139434817 16:66930305-66930327 CAATCTGGGCATAGGGCCAAGGG + Intergenic
1139436473 16:66939504-66939526 CAGACTGGGCAGCTGGCCCCTGG + Intronic
1140462935 16:75155973-75155995 AAGTCTTGGCAAAGGGCCCACGG - Intronic
1141618761 16:85225356-85225378 CAGTCAGTGCAGAGGGCCCGAGG + Intergenic
1141690842 16:85595392-85595414 AAGTCTCCGCAGAGGGGCCTTGG - Intergenic
1142126322 16:88412300-88412322 CAGGCTGTGGAGAGGGCACTGGG - Intergenic
1142289114 16:89184669-89184691 CAGGCTGGGCAGAGGACGCAGGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1143666226 17:8362751-8362773 CAGCCAGGGCCGAGGGCCCAGGG + Intergenic
1144640130 17:16932351-16932373 GAGCCTGGTCAGAGGGTCCTGGG - Intronic
1144784109 17:17822515-17822537 CAGCTGGGGGAGAGGGCCCTTGG - Intronic
1144839329 17:18175936-18175958 CAGTGAGGGCAGAGGGCCCAGGG - Intronic
1146458886 17:33028206-33028228 CAGGGTGGCCACAGGGCCCTGGG - Intronic
1146909841 17:36641616-36641638 CAGTGGGGGCAGACGGGCCTGGG - Intergenic
1147456018 17:40538634-40538656 CAGTGTGGGCATGGGGCCCAAGG - Intergenic
1147561677 17:41513170-41513192 CAGGCTGTGAAAAGGGCCCTGGG + Intergenic
1148090878 17:45021923-45021945 GAGCCTGGGCTGCGGGCCCTGGG - Intergenic
1148553463 17:48564290-48564312 CAGCCTGGGCCGAGGGTCCGGGG - Intronic
1148844460 17:50521075-50521097 CAGCCTGTGCTGAGGGTCCTTGG + Intronic
1148872207 17:50665155-50665177 CAGCCAGGACAGAGGGACCTAGG - Exonic
1149446054 17:56714262-56714284 CAGTCTGGGCAAAGAGACATAGG + Intergenic
1150815254 17:68387679-68387701 CAGTCTGGGCGGAGGGTGCCGGG - Intronic
1151385218 17:73751147-73751169 CAGCACAGGCAGAGGGCCCTGGG + Intergenic
1151830265 17:76545173-76545195 CAGACTGCGCAGAGAGCCCAGGG - Intronic
1152086779 17:78224764-78224786 CTGTCTGGGCAGATGGCTGTTGG - Exonic
1152469351 17:80482242-80482264 CTGGCTGGGGACAGGGCCCTGGG + Intergenic
1152626191 17:81388901-81388923 CACACTGGTGAGAGGGCCCTAGG - Intergenic
1152730081 17:81965862-81965884 CAGGCTGGGCACAGGGCACCAGG + Intergenic
1153697949 18:7663566-7663588 CAGTCTGGGCAGGGTTCCGTGGG + Intronic
1154322607 18:13367322-13367344 CAGGTGGGGCAGAGGGGCCTGGG + Intronic
1154447979 18:14450297-14450319 CAGCCTGCGCAGCGGGCACTCGG + Intergenic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1157693428 18:49701766-49701788 CAGTCTAGGCAGAAAGCCCAGGG + Intergenic
1157695085 18:49716180-49716202 CAGTCTGGCCACAGCGGCCTTGG + Intergenic
1157737390 18:50062290-50062312 CAGTCTGGGCAGAGTTCCCTGGG + Intronic
1157937624 18:51890891-51890913 CAGCCTGGGAAGAGGGCCAGAGG - Intergenic
1158672417 18:59488610-59488632 AAGTCTGGGCACTGGGCCTTGGG + Intronic
1159795542 18:72838552-72838574 GAGTCTGGGCGGAGGAGCCTGGG - Intronic
1160034784 18:75290537-75290559 CAGACTGGGCAGTGAGTCCTGGG - Intergenic
1160458945 18:79022825-79022847 GAGTCAGGGCAGCGGGTCCTGGG + Intergenic
1160501233 18:79401921-79401943 CAGCCAGGGCCGAGGGCCCAGGG - Intronic
1161013864 19:1973565-1973587 CAGCCAGGGCTGAGGGACCTGGG - Intronic
1161605655 19:5213378-5213400 CAGCCTGGGCAGAGGCCCTGGGG - Intronic
1161766207 19:6210301-6210323 TAGTCGGGGCAGGGGGCCCCAGG + Intergenic
1161976020 19:7608043-7608065 CAGGCTGGGCAGGGAGGCCTGGG - Intronic
1162189019 19:8930207-8930229 GAGTCTCCGCAGTGGGCCCTGGG - Intronic
1162771754 19:12953502-12953524 CAGACTGGGGAGGGGGCCTTGGG - Exonic
1162782807 19:13015400-13015422 CAGGCTGGGCCTAGGGTCCTGGG - Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1164078694 19:21844114-21844136 CAGTCTGGGCCTAGGGCCGCAGG - Intronic
1164617713 19:29676770-29676792 CTGCCTGGGCAGAGGGCACAGGG + Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1165743895 19:38219055-38219077 CAGTCTGGGGACAGGGCCATGGG + Exonic
1167320455 19:48794616-48794638 CAGTCCTGGCTGAGGGCACTGGG + Intergenic
1167424976 19:49425565-49425587 CAGTCTGGGCAGAGAAGCATAGG - Intronic
1167463186 19:49636981-49637003 CAGTGGGGGCTGAGGGCTCTTGG - Intronic
1167526778 19:49989193-49989215 CAGACTAGGAAGAGGGCCCAGGG - Intronic
1167738850 19:51312085-51312107 CTGGCTGGGCAGGGGGACCTCGG + Intronic
1167752213 19:51387953-51387975 CAGTCTGCACAGAGGGGCCGTGG - Exonic
1168403503 19:56099171-56099193 CAGTGTGGCTCGAGGGCCCTGGG - Intronic
926687181 2:15707150-15707172 AAGTCAGGGATGAGGGCCCTTGG - Intronic
926890363 2:17634232-17634254 CCTTCTGAGCACAGGGCCCTGGG - Intronic
927062955 2:19441379-19441401 CAGTGTTGGAAGAGGGGCCTGGG - Intergenic
928193216 2:29193397-29193419 CAGTCAGCGAAGAGGGCTCTAGG + Exonic
929096668 2:38268874-38268896 CAATCTCTGCAGAGGGTCCTGGG - Intergenic
929438539 2:41947773-41947795 CAGTCTGGGGTGAGGGCCACGGG - Intronic
930667610 2:54115442-54115464 CAGTCCGGGAAGAGAGGCCTAGG + Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931691490 2:64838078-64838100 CAAGCTGGGCAGAGTGCCCTGGG + Intergenic
932002532 2:67897794-67897816 CAGGTTGGGGAGAGGGCCCTGGG - Intergenic
932303791 2:70687188-70687210 CACTCTGGGCTGTGTGCCCTTGG - Intronic
932567916 2:72921026-72921048 ACGGCTGGGCGGAGGGCCCTAGG - Intronic
932574336 2:72954577-72954599 CGGGCAGGGGAGAGGGCCCTGGG - Intronic
932872746 2:75419731-75419753 CAGTCTTGGCAGAGGGTCAGTGG + Intergenic
933993028 2:87647259-87647281 CTGTCTCTGCAGAGGCCCCTTGG - Intergenic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
934780775 2:96968424-96968446 CAGGCTGTGGAGAGAGCCCTGGG + Intronic
934902117 2:98167732-98167754 GAGTCTGGGGAAAGGGCCATTGG + Intronic
935356083 2:102201064-102201086 CAGTCTTGGCAGAGGGTCTTGGG + Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936300829 2:111303620-111303642 CTGTCTCTGCAGAGGCCCCTTGG + Intergenic
937229324 2:120388382-120388404 CAGCCTGGGCAGAGAGCACTGGG + Intergenic
937271596 2:120656446-120656468 CTCCCTGAGCAGAGGGCCCTGGG - Intergenic
938206978 2:129432170-129432192 AAGTGTGGGCCGAAGGCCCTGGG - Intergenic
938225397 2:129611547-129611569 CAGTCTTTGCAGAGGACCCAGGG - Intergenic
938262479 2:129905678-129905700 GAGTCTGGGCTGGGGGCCATGGG - Intergenic
943342059 2:186693855-186693877 CAGCCCGGGTGGAGGGCCCTAGG - Intergenic
943680526 2:190762370-190762392 CAGTCTGGGTAAAGGACTCTGGG - Intergenic
947612468 2:231532533-231532555 CGCACTGTGCAGAGGGCCCTAGG + Intergenic
947716580 2:232342782-232342804 CAGGCTGGGCTGGGGCCCCTGGG + Intronic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
947866345 2:233400427-233400449 CAGACAGGGCAGTGGGCACTGGG - Intronic
947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG + Intergenic
947913710 2:233818800-233818822 CAGGCTGGTCTCAGGGCCCTTGG + Intronic
948564659 2:238876224-238876246 CAGCCTCTGCAGAGGGCACTAGG + Intronic
949017991 2:241724370-241724392 CTGTTAGGGCGGAGGGCCCTGGG + Intronic
1168893554 20:1309098-1309120 TTCTCTGGGCAGAGGCCCCTGGG - Exonic
1169214112 20:3783951-3783973 CATCCTGGGCAGAGGGGCCTGGG - Exonic
1170940755 20:20846096-20846118 CACTCTGGGCACTGGGCACTGGG + Intergenic
1171365273 20:24618313-24618335 CAGTGAGGGCAGAGAGCCCAGGG + Intronic
1173607731 20:44343518-44343540 CCGTCAGGGCTGAGGGCCCCTGG + Intronic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1175215076 20:57388037-57388059 CAGGCTGGGCAGAGGTGACTTGG - Intergenic
1175294795 20:57900760-57900782 GGGTCTGTGCTGAGGGCCCTGGG + Intergenic
1175505862 20:59483704-59483726 CAGTCAGGGCTGAGAACCCTGGG - Intergenic
1175934261 20:62507844-62507866 CGGTGTGGCCAGAGGGCCTTCGG + Intergenic
1175957606 20:62619255-62619277 CAGTCTGGGCCGTGGTTCCTAGG - Intergenic
1175987176 20:62769971-62769993 CAGCCCAGGCAGAGAGCCCTGGG - Intergenic
1176018624 20:62951744-62951766 CTTTCTGTTCAGAGGGCCCTGGG + Intergenic
1176448245 21:6840398-6840420 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1176826415 21:13705420-13705442 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1180914168 22:19473813-19473835 CAGGCTGGGCAAAGAGCCCGAGG + Intronic
1181984509 22:26790182-26790204 AAGTCTCGGCAGAGCTCCCTGGG - Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182279813 22:29211754-29211776 CAATCTGGGCAGAGGACAGTCGG - Intronic
1182422985 22:30257550-30257572 CAGTAGGTGCAGAGGGCCCTGGG + Intergenic
1183455811 22:37922439-37922461 CAGTCAGGGCAGGGGGCACCGGG + Intronic
1183521690 22:38299356-38299378 AACACTGGGGAGAGGGCCCTTGG + Intronic
1183980076 22:41534185-41534207 CAGTCTGGGCACTGGGCTCACGG + Intronic
1184091527 22:42295380-42295402 CAGCCAGGGCAGAGGCCCCAAGG - Intronic
1184231335 22:43159882-43159904 CAGTCTGGCCTGAGTCCCCTGGG + Intronic
1184409061 22:44316189-44316211 CACCCTGGGGAGAGGGACCTGGG + Intergenic
1185018240 22:48358164-48358186 CGGAGTGGGCAGGGGGCCCTCGG + Intergenic
1185213862 22:49587467-49587489 CTGGCTGGGCTGAGAGCCCTGGG - Intronic
1185214049 22:49588291-49588313 CCATCTGGGCAGAGGGTCCAGGG - Intronic
950638740 3:14334183-14334205 CACTCTGGGCAGAGGGGGCTGGG - Intergenic
951624529 3:24645147-24645169 CAGCCTGGGCACAGGGCTCAGGG + Intergenic
952018158 3:28984487-28984509 CAGTCTGGGAGGAGGGGTCTAGG - Intergenic
953381857 3:42478124-42478146 CTGTCTGGGGAGTGGGCCCAGGG - Intergenic
953573557 3:44093878-44093900 TAGTGTGGCCAGAGGTCCCTGGG - Intergenic
953747015 3:45583054-45583076 CTCTCTGAGCAGATGGCCCTGGG + Intronic
953897432 3:46812751-46812773 CACTCTGAGGCGAGGGCCCTAGG - Intergenic
954025836 3:47782258-47782280 CAGTCCGGGTGCAGGGCCCTCGG - Intergenic
954627369 3:52029881-52029903 CTGTCTGCCCAGAGGGGCCTCGG + Intergenic
954649795 3:52154197-52154219 CTGTCTGCGCAGGGGGCGCTGGG - Intronic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
959943348 3:112102564-112102586 CAGACTGGGGAAAGGGCCCAAGG - Intronic
960818419 3:121699108-121699130 CAGGATTGGCAGAGTGCCCTTGG - Intronic
967124126 3:186409299-186409321 CTGTCTGGGGAGAGAGCCCTGGG - Intergenic
968486447 4:865312-865334 CAGGCTGTGCTCAGGGCCCTAGG + Intronic
968734555 4:2288593-2288615 CAGTGTGAGCTGAAGGCCCTTGG + Intronic
969457736 4:7309780-7309802 CAGGCTGGGGAGAGGGCCTGAGG + Intronic
970254016 4:14148031-14148053 AGGTCTGGGCAGAGGTCCCAAGG + Intergenic
982595856 4:157382015-157382037 CAGTGTGGGCAGAGGCCCTAAGG - Intergenic
984024003 4:174521859-174521881 CAGCCCGGCCAGGGGGCCCTGGG - Intronic
985937000 5:3105047-3105069 CAGGATGGTCAGAGGGCACTGGG - Intergenic
991609468 5:68435574-68435596 CAGCCAGGGCACATGGCCCTGGG - Intergenic
992312002 5:75511072-75511094 GAGTCTGGCCAGGGGTCCCTTGG + Intronic
992878685 5:81083329-81083351 AAGTCTGGACAGAGGTCTCTTGG - Intronic
994286133 5:97970604-97970626 CACTCTTGACAGAGGGACCTAGG - Intergenic
995417140 5:111924395-111924417 CAGTCTGGCCAGAGAGATCTTGG + Intronic
996699395 5:126435168-126435190 CAGTCTGGGGAGAGGGGAATGGG + Intronic
997215930 5:132110687-132110709 AAGTCTGGGCAGAGAGCCTCAGG - Intergenic
997950861 5:138241756-138241778 CAGCCTGGGCCGAGAGCGCTGGG + Intergenic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
999266340 5:150269316-150269338 CATTCTGGGGTGAGGTCCCTGGG + Intronic
999381927 5:151127390-151127412 CATTCTGGGAAGAGGCCCCCAGG + Intronic
999796642 5:154995048-154995070 CAGTCTGTGCTGAGGACCTTAGG + Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001030983 5:168262577-168262599 CAGGCGAGACAGAGGGCCCTGGG + Exonic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1001600329 5:172924168-172924190 CAGAGAGGGCAGAGGGCACTGGG - Intronic
1002518002 5:179773778-179773800 CACACTGGGAAGAGGGCCCCGGG - Intronic
1002603158 5:180366447-180366469 CACTCTGGGCTCCGGGCCCTGGG - Intergenic
1002641226 5:180631560-180631582 GAGTCAGGGCAGAGTGGCCTCGG - Intronic
1002710959 5:181194860-181194882 CAGTCAGGGCAGAAGCCCCCTGG + Exonic
1003528285 6:6916745-6916767 CAGTCCAGACAGAAGGCCCTGGG + Intergenic
1006119090 6:31793101-31793123 CAGGCTGTGCTGGGGGCCCTGGG - Exonic
1006162631 6:32047155-32047177 CAGTCTGGGCCTGGGTCCCTGGG - Intronic
1007112784 6:39322615-39322637 CAGCCTGGGCACAGGCCCCTAGG - Intronic
1007394159 6:41567924-41567946 CACTATGGGCAGAGTGCCCAGGG + Intronic
1011231417 6:85165764-85165786 CAGTCCGTGCAGGTGGCCCTGGG + Intergenic
1013154535 6:107480928-107480950 GAGCCTGGGCAGAAGGTCCTGGG - Intergenic
1017965854 6:159265414-159265436 GAGTCTATGCAGAGGGACCTGGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018365552 6:163116525-163116547 CAGTGTGTGCAGAGCGCTCTTGG + Intronic
1018834192 6:167470988-167471010 CAGGCAGGACTGAGGGCCCTTGG + Intergenic
1019215888 6:170443563-170443585 CACTGTGGGAAGAGGGCTCTTGG + Intergenic
1019576879 7:1741838-1741860 CTGTCTGGGCAGCGAGGCCTGGG - Intronic
1023340494 7:39214253-39214275 CAGCCTGTGCAAAAGGCCCTGGG - Intronic
1023721047 7:43095338-43095360 AAGTCTGGGAAGAGGCCACTCGG - Intergenic
1023760934 7:43464613-43464635 CAGTCTGGGCAGGCAGCACTGGG + Intronic
1025094001 7:56083844-56083866 CAGTCTGGGGAGAGGAGCCGGGG + Intronic
1026633383 7:72058662-72058684 CACCCTGGGCAGAGGGCCAAGGG + Intronic
1027252632 7:76408666-76408688 CAGGCTTGGCAGAGGGCTCTGGG - Intronic
1029506966 7:100968555-100968577 GACTCTGGGCAGGGGCCCCTTGG + Intergenic
1031426853 7:121615674-121615696 CAGTCTGTAAAGAGGGCCTTAGG - Intergenic
1031998405 7:128247870-128247892 GAGTCAGAGCACAGGGCCCTAGG - Intronic
1032077563 7:128843284-128843306 AAGTCAAGGCCGAGGGCCCTGGG + Exonic
1032482709 7:132259567-132259589 CAGTCTGGCTGGAGGGCCTTGGG - Intronic
1032541392 7:132705886-132705908 CAGTGTGTCCAGAGGGCCTTGGG - Intronic
1032750466 7:134834885-134834907 CATTTTGTGCACAGGGCCCTGGG - Intronic
1034407785 7:150916772-150916794 CAGTCTGTCCAGAGGACCCATGG + Intergenic
1034494500 7:151411440-151411462 CTTTCTGGGCAGAGGGGCCAAGG + Intergenic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1036063031 8:5346415-5346437 CAGTCTGGGCATTGGTCCCATGG + Intergenic
1036570243 8:9974068-9974090 CTGCCTGGGCAGAGTGGCCTGGG + Intergenic
1039376612 8:37040928-37040950 AAGGCTGGGAAGAGGGTCCTGGG + Intergenic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1040422208 8:47251351-47251373 CAGTTTGGGCCGAGGGGGCTGGG + Intergenic
1042390744 8:68230746-68230768 CAGTCGGGTGAGTGGGCCCTGGG + Intronic
1042397630 8:68310754-68310776 CAGTCATGGCAGAGTGCACTGGG + Intronic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1046984198 8:120369421-120369443 CAGGCTGGCCAGAAGGACCTTGG - Exonic
1048554682 8:135463208-135463230 ACGTCTGAGCACAGGGCCCTTGG + Intronic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1050842862 9:10174369-10174391 CAGCCTGTGCAGAGGTCACTTGG - Intronic
1055418843 9:76114322-76114344 CAGTCCTGGCAGAAGGCCCGTGG - Intronic
1056007873 9:82292768-82292790 CATTCTTGGAAGAGAGCCCTAGG + Intergenic
1057442570 9:95092478-95092500 CTGTCTGGGCAGGCGGCCCCAGG - Intergenic
1057791422 9:98127459-98127481 CAGAGTGGGCAGAGGGACCTGGG + Intronic
1058531701 9:105912301-105912323 CAGGCTGGGCAGAGGAGTCTAGG - Intergenic
1060218058 9:121750350-121750372 CAGGCAGTGCAGTGGGCCCTGGG - Intronic
1060403743 9:123362728-123362750 CAGTATGGACAGAGGGCCAGGGG - Intronic
1061222852 9:129262287-129262309 CTCTCTGGGCAGAGGGGTCTGGG + Intergenic
1061801278 9:133114597-133114619 CAGCCCGGCCAGAGTGCCCTGGG - Intronic
1062181922 9:135195521-135195543 CATTCAAGGCAGAGGGACCTGGG - Intergenic
1062400008 9:136368281-136368303 CAGTCTGGGCAGAAGGGGTTAGG - Intronic
1062607827 9:137355921-137355943 CAGCCTGTCCAGAGGGGCCTGGG + Intronic
1062689772 9:137835156-137835178 CAGCCTGGGCACTGGGCCCGCGG - Exonic
1203520946 Un_GL000213v1:44120-44142 CAGCCTGAGCAGCGGGCACTTGG + Intergenic
1185531408 X:821938-821960 CATTCTGCATAGAGGGCCCTTGG - Intergenic
1189243176 X:39541337-39541359 CAGTCTGGAGAGAGGGTCCGAGG - Intergenic
1189516443 X:41717639-41717661 CAGTCTTGTCAGAGTGCTCTCGG - Intronic
1190004827 X:46725768-46725790 CAGGCTGGGCAGTGGAGCCTTGG + Intronic
1191903199 X:66059841-66059863 TAGTATGGGCTGTGGGCCCTAGG + Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1196792262 X:119474787-119474809 CACTGAGTGCAGAGGGCCCTTGG - Intergenic
1198524461 X:137486704-137486726 TAGTCTGGGCAGAGGTTTCTTGG + Intergenic
1198674768 X:139120133-139120155 CAGTCTTGGCAGAAGGCTATGGG - Intronic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200771094 Y:7126155-7126177 CAGTCTGTGCCGAGGCCCCCAGG + Intergenic
1201148614 Y:11081950-11081972 CTGTCTAGGCAGAGGGGCTTTGG + Intergenic