ID: 1000353983

View in Genome Browser
Species Human (GRCh38)
Location 5:160375585-160375607
Sequence CTGAATCTTCAGAATATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000353982_1000353983 -8 Left 1000353982 5:160375570-160375592 CCACTTATGCTGCATCTGAATCT No data
Right 1000353983 5:160375585-160375607 CTGAATCTTCAGAATATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000353983 Original CRISPR CTGAATCTTCAGAATATCAA AGG Intergenic
No off target data available for this crispr