ID: 1000356078

View in Genome Browser
Species Human (GRCh38)
Location 5:160397191-160397213
Sequence CACAACCTGGTTAAGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000356074_1000356078 29 Left 1000356074 5:160397139-160397161 CCAGAAGCAGAACAAAAGAATAT 0: 1
1: 0
2: 3
3: 38
4: 433
Right 1000356078 5:160397191-160397213 CACAACCTGGTTAAGTAGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000356078 Original CRISPR CACAACCTGGTTAAGTAGTC AGG Intronic
901094136 1:6664739-6664761 CACAACTTGGCACAGTAGTCAGG + Intronic
904130426 1:28271776-28271798 CAGAAGCTGGTAAAGTAGTCAGG - Exonic
908532244 1:65044903-65044925 AACAACCTGGTAATGTAGGCTGG - Intergenic
910248785 1:85171863-85171885 CACAACCTGTTCAAGAAATCTGG + Intronic
911134091 1:94420281-94420303 TACAAACTGGTTTAGTAGTTAGG - Intronic
912169926 1:107087177-107087199 CACTAGCAGGTTAAGTTGTCTGG + Intergenic
913036511 1:114971111-114971133 CATCACCTGGATAAGTATTCAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
919520557 1:198582623-198582645 GGAAACCTGGTTAAGTATTCAGG + Intergenic
920902055 1:210119850-210119872 CACAACCTTGTGAAGTACCCAGG - Intronic
923994961 1:239483767-239483789 AACAACCTGGTTAAGTAGATGGG - Intronic
1064479399 10:15724306-15724328 CACTAACTGGTTAAATGGTCTGG - Intergenic
1069378690 10:67820075-67820097 CACAAACTGGCCAAGTAGTCAGG + Intronic
1071339238 10:84627816-84627838 CACAACCTGGTTAAGCACACGGG + Intergenic
1071342299 10:84660094-84660116 CTCAACCTGGATGAGCAGTCAGG - Intergenic
1071906474 10:90179924-90179946 CACATCCTGGATAAGTAGCAGGG + Intergenic
1082983877 11:59149719-59149741 CATAACCTTGTTAGGAAGTCAGG + Intronic
1085240603 11:75050910-75050932 GCAAACCTGGTTAAGTATTCTGG + Intergenic
1089750285 11:120646888-120646910 AACAGCCTGGTGAAGTAGGCAGG + Intronic
1091081402 11:132672231-132672253 CACAGCCTGGTTAAGCCCTCGGG + Intronic
1093604471 12:21073602-21073624 GATCACCTGGTTAAGTATTCAGG + Intronic
1110129449 13:71989045-71989067 CACATCCTGGTCATGTACTCTGG + Intergenic
1113511908 13:110863262-110863284 AAGAACCTGGTTCAGAAGTCAGG + Intergenic
1114542116 14:23468759-23468781 CACAAGCTGGTGAAGTAGGTTGG - Intergenic
1118887450 14:69879051-69879073 AACATCCTGGTGAAGTAGGCAGG - Intronic
1125884207 15:43216254-43216276 CACAAACTGGTTAGTGAGTCAGG - Exonic
1126073169 15:44883555-44883577 CACATCCTGGTTAAGAAATGAGG - Intergenic
1126085092 15:45004083-45004105 CACATCCTGGTTAAGAAATGAGG + Intergenic
1148159864 17:45443754-45443776 CACCACCTGGTTAGGTGGGCAGG + Intronic
1151078835 17:71304888-71304910 GGCCACCTGGTTAAGTATTCAGG - Intergenic
1151910529 17:77079900-77079922 CACAACCTGAGTAAGTTGTTGGG + Intergenic
1155714199 18:28919856-28919878 CACAACCAGGTTCTGCAGTCTGG - Intergenic
1162113536 19:8414382-8414404 CTCACCCTGGTCAAGTAGTTGGG + Intronic
925865150 2:8220685-8220707 CAGAACCTGTTTAGGTAGACTGG - Intergenic
929629194 2:43441982-43442004 TAAAACCTGGTTAAGAAGACAGG + Intronic
932731914 2:74227405-74227427 CACAAACTGTTTAAGAATTCTGG + Intronic
932986539 2:76732503-76732525 AACCACCTGGTTAAGAACTCTGG - Intergenic
947053054 2:226068382-226068404 AACAACCTGGTAAAGTAATTTGG - Intergenic
1168868218 20:1107238-1107260 CACAATCTGGTCAAGCAGTCAGG - Intergenic
1172302892 20:33862667-33862689 CACACCCTGGTCAGGTAGTTTGG - Intergenic
949263467 3:2129774-2129796 TACAATCTGGTTAAGTAGGTAGG - Intronic
951302638 3:21017441-21017463 GAATACCTGGTTAAGTATTCAGG + Intergenic
952339235 3:32431719-32431741 CACAGCCAGGTTAAGGAGCCAGG - Intronic
957663700 3:83194998-83195020 AACAAACTGGCTAAGTAGTGTGG + Intergenic
960164583 3:114387105-114387127 AATAATCTGGTTAAGTAGGCAGG + Intronic
964034877 3:152183527-152183549 TACAACCTGTTTAAGTTGTATGG - Intergenic
965184592 3:165446700-165446722 GCACACCTGGTTAAGTAGTCAGG - Intergenic
967421647 3:189279769-189279791 AACAACCTGAATTAGTAGTCAGG - Intronic
971554923 4:28001963-28001985 GGAAACCTGGTTAAGTATTCAGG + Intergenic
971683469 4:29732702-29732724 CACCAACAGGTTAAGTTGTCTGG - Intergenic
972350737 4:38233987-38234009 CACCACCTGGTAAAGTAGGATGG + Intergenic
974035079 4:56811005-56811027 CACACCCTGTATTAGTAGTCGGG - Intronic
976478071 4:85507665-85507687 CACAACCCGGTGAAGAAGTGAGG - Intronic
979433932 4:120666368-120666390 CACTACCTGGTTGTGTAGTATGG - Intergenic
982062393 4:151617398-151617420 CAAAACCAGGTTAAGGACTCTGG - Intronic
982829787 4:160044763-160044785 GGCCACCTGGTTAAGTATTCAGG - Intergenic
986779838 5:11055189-11055211 CACAACTTGTTTAGGTAGCCTGG - Intronic
989073154 5:37533510-37533532 GAATACCTGGTTAAGTATTCAGG + Intronic
990493466 5:56323703-56323725 CACAGCCTGGTTCTGTAGTCTGG - Intergenic
1000356078 5:160397191-160397213 CACAACCTGGTTAAGTAGTCAGG + Intronic
1000910037 5:167011002-167011024 CAAAAACAGGTTAAGTAGACTGG + Intergenic
1006548470 6:34800259-34800281 CAGAACCTGGTTGAATAATCTGG + Intronic
1010518438 6:76803094-76803116 GAATACCTGGTTAAGTATTCAGG + Intergenic
1017814070 6:158004299-158004321 CACAACCTGTTTTAGCAGTAAGG - Intronic
1018058215 6:160070439-160070461 CATAACTTGGTTAATTACTCAGG + Intronic
1022253178 7:28629011-28629033 GACAACTTGGTTTAGAAGTCTGG - Intronic
1036732220 8:11275885-11275907 TACGACCTGGTGAAGTAGACAGG - Intergenic
1041005248 8:53491818-53491840 GACAACCTGATTTAGTAGTTGGG + Intergenic
1042431428 8:68710764-68710786 GAACACCTGGTTAAGTATTCAGG - Intronic
1042575166 8:70210137-70210159 CACAGAGTGGTTAAGTAGCCTGG - Intronic
1046849723 8:118958418-118958440 CAAAACCCTGTTAAGTGGTCTGG - Intergenic
1050205313 9:3189986-3190008 CACAACCAGGTTAAGTGTTGTGG - Intergenic
1055156348 9:73067186-73067208 GAACACCTGGTTAAGTATTCAGG - Intronic
1187287864 X:17923350-17923372 AACAACCAGGTGAAGTAGACAGG - Intergenic
1190151981 X:47956735-47956757 AACAACCTGGCTAAATAGTTTGG - Intronic
1190160676 X:48029414-48029436 AACAACCTGGCTAAATAGTTTGG + Intronic
1200931960 Y:8704994-8705016 CACAACCTGGCTCAGTGTTCAGG - Intergenic