ID: 1000365238

View in Genome Browser
Species Human (GRCh38)
Location 5:160484592-160484614
Sequence TCCCTCCCTCTTCTCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000365238_1000365242 30 Left 1000365238 5:160484592-160484614 CCAAGCCTGAGAAGAGGGAGGGA No data
Right 1000365242 5:160484645-160484667 ATCCAGCACTTTGTCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000365238 Original CRISPR TCCCTCCCTCTTCTCAGGCT TGG (reversed) Intergenic
No off target data available for this crispr