ID: 1000366440

View in Genome Browser
Species Human (GRCh38)
Location 5:160495583-160495605
Sequence CTTTAGATCTTTAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000366435_1000366440 4 Left 1000366435 5:160495556-160495578 CCATTTCTGAAATCAACTGGACC No data
Right 1000366440 5:160495583-160495605 CTTTAGATCTTTAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000366440 Original CRISPR CTTTAGATCTTTAGGGAAGT AGG Intergenic
No off target data available for this crispr