ID: 1000370984

View in Genome Browser
Species Human (GRCh38)
Location 5:160536403-160536425
Sequence GCAAAGTAGTTTGCGTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000370984_1000370986 -1 Left 1000370984 5:160536403-160536425 CCTGGTGACGCAAACTACTTTGC No data
Right 1000370986 5:160536425-160536447 CCTTGCCTTTTACATTCTGAAGG No data
1000370984_1000370988 11 Left 1000370984 5:160536403-160536425 CCTGGTGACGCAAACTACTTTGC No data
Right 1000370988 5:160536437-160536459 CATTCTGAAGGTTCTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000370984 Original CRISPR GCAAAGTAGTTTGCGTCACC AGG (reversed) Intergenic
No off target data available for this crispr