ID: 1000378219

View in Genome Browser
Species Human (GRCh38)
Location 5:160603990-160604012
Sequence CAAGCTGCTGATATTGGAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000378219_1000378221 18 Left 1000378219 5:160603990-160604012 CCAATTCCAATATCAGCAGCTTG 0: 1
1: 0
2: 0
3: 6
4: 162
Right 1000378221 5:160604031-160604053 TGCTCCATCACCTGAAAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000378219 Original CRISPR CAAGCTGCTGATATTGGAAT TGG (reversed) Exonic
909003365 1:70245600-70245622 CTACTTGCTGATATTGGAAGAGG + Intronic
909654478 1:78015335-78015357 CAAGATGCAGGGATTGGAATGGG - Intronic
911423671 1:97679094-97679116 AAAGCTGCTTTCATTGGAATAGG - Exonic
916151109 1:161791901-161791923 CAAGCTGCAGTTTTGGGAATGGG - Intronic
917059254 1:171018387-171018409 GAGGCTGCTGACATTTGAATAGG - Intronic
918316751 1:183328820-183328842 CAATCAACTGATGTTGGAATGGG - Intronic
922014810 1:221634500-221634522 CCAGCTGCTGATATATGCATAGG + Intergenic
923517667 1:234710785-234710807 CATGCATGTGATATTGGAATTGG - Intergenic
1064833569 10:19499552-19499574 CACCCTGCAGATATTGGACTTGG + Intronic
1066620645 10:37345529-37345551 CAAGCTGCTGCTCATGGAACTGG - Intronic
1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG + Intergenic
1068399333 10:56508572-56508594 CCAGCTGCAGATATTTGCATAGG + Intergenic
1068666912 10:59686545-59686567 CTCGCTGCTAATATTGTAATTGG + Intronic
1069420183 10:68239934-68239956 CAAGCTGCTGAAATTGCACAAGG - Intergenic
1072362990 10:94677996-94678018 CAAGGAGGTGATATTGGGATAGG + Intergenic
1075985088 10:126778298-126778320 CAGGCTGCTGATCTGGGAAGTGG + Intergenic
1076709493 10:132324113-132324135 CCAGCTGCTGTGATTGGAGTGGG - Intronic
1077467592 11:2740915-2740937 CAAGCAGCTGATCGTGCAATGGG - Intronic
1077482003 11:2819359-2819381 CAAGCTGGGGATTTGGGAATGGG + Intronic
1081752716 11:45523471-45523493 GAAGCTGCTGATCTTAGAGTAGG + Intergenic
1083797586 11:65026419-65026441 GAAGCTGCTGAGATGGGAAAGGG - Intronic
1089535479 11:119158395-119158417 CCAGCAGCTGAAATGGGAATGGG + Intronic
1090674738 11:128980680-128980702 CAAACTGCTGACATTGGAAGAGG - Exonic
1093480255 12:19597262-19597284 GAAGATGATGATTTTGGAATGGG + Intronic
1095374044 12:41505128-41505150 GAAACTGCTGACATTCGAATGGG - Intronic
1098864018 12:75741672-75741694 GAAGCTGCTGGTCTGGGAATGGG - Intergenic
1099349040 12:81541868-81541890 CAGGCTTCTCATATTGGAGTTGG + Intronic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1100236673 12:92668534-92668556 CAGGCTGCAGATTTTGGAAGAGG + Intergenic
1100977366 12:100136418-100136440 CATGCTTCTTATATTAGAATAGG + Intronic
1102616301 12:114157666-114157688 CAAGCAGCCGATATTGCCATTGG + Intergenic
1110161924 13:72388802-72388824 CAAGCTGATGGTATTGTATTAGG + Intergenic
1112532282 13:100216727-100216749 TATGCTTCAGATATTGGAATTGG + Intronic
1112867290 13:103920416-103920438 TAATCTGCTGATATCAGAATTGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114808403 14:25864816-25864838 GAAGCTCCTGAAATAGGAATAGG - Intergenic
1115936820 14:38561505-38561527 CCAGCTGCTGGTGTAGGAATTGG + Intergenic
1116538254 14:46063691-46063713 CAAGATGTTGATAGTGGAAGGGG - Intergenic
1116611050 14:47072584-47072606 GATGCTGCTGATATTGGACTAGG - Intronic
1119129150 14:72155750-72155772 CAAACAGCTGATATTAGAAGGGG - Intronic
1120594024 14:86412292-86412314 CAAGGTGCTCATATTCTAATGGG + Intergenic
1120751014 14:88198412-88198434 CATGCTGCTGAAATTTGAGTAGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124610696 15:31206525-31206547 CAGGCTGCTCATTTTGTAATTGG - Intergenic
1125525239 15:40370173-40370195 CAAGCTGCTGTGATGGGAAGCGG - Exonic
1129900012 15:79140018-79140040 CAAGCTTCTCATCTTGGAAAGGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1135730524 16:24891266-24891288 AAAGCTGCTGATATTTGCAAAGG + Intronic
1140800555 16:78484388-78484410 CCAGCAGCTGGTATTTGAATTGG + Intronic
1141879299 16:86847240-86847262 CCAGTTGCTGATATGGGAACTGG + Intergenic
1142703065 17:1676229-1676251 CAAGTTGCTCATCTTGGCATTGG - Exonic
1144237519 17:13275978-13276000 CAAGCTTCTGATAAAGGAAAGGG + Intergenic
1145354289 17:22124860-22124882 AAAACTACTGATATTGGATTAGG + Intergenic
1146640073 17:34533686-34533708 CCAGCGGCAGAAATTGGAATGGG + Intergenic
1150498539 17:65628214-65628236 GAAGCTGCTGAAATAGAAATGGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156836908 18:41565927-41565949 CATGCTGCTGATTCTGGAAATGG + Intergenic
1157910264 18:51610763-51610785 CAGCCTGCTGATGGTGGAATGGG + Intergenic
1159942594 18:74419952-74419974 CAAGCTGCTGAAATGGGCAGAGG - Intergenic
1160815838 19:1035303-1035325 CAAGGTCTTGACATTGGAATTGG + Intronic
1161662956 19:5558568-5558590 CAGGCTGCTGATTTTGGATCTGG - Intergenic
1161983463 19:7642223-7642245 CCAGCTGCTGATAATGGACCGGG + Exonic
1162536807 19:11267397-11267419 CATGGAGCTGACATTGGAATGGG - Intergenic
1167806807 19:51792621-51792643 CAAGTTGCTCATATTGGCTTAGG - Intronic
1168709954 19:58493733-58493755 CAAGCTGCTGTAATTAGCATAGG - Intronic
926667933 2:15545196-15545218 AAAGATGCTTATATTAGAATAGG + Intronic
932982693 2:76689030-76689052 CAAGCTGATGGTATTAGAAGTGG - Intergenic
935795268 2:106634869-106634891 GATGCTGGTGATATTGGATTAGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
941111946 2:161425959-161425981 CAGGCTGCCCATATTGGAGTGGG - Intronic
941282341 2:163568663-163568685 AATGCTGCTGATGTTGGTATAGG + Intergenic
943525358 2:189009267-189009289 AAAGCTGCTTAGATTAGAATGGG + Intronic
945216130 2:207436061-207436083 CAAGCCGCTGAAATTTGCATTGG - Intergenic
947373814 2:229475227-229475249 AAAGCTGGTGATAGTGGAACTGG + Intronic
948629087 2:239290559-239290581 CAAGCTCCTGAAATGGGAGTAGG + Intronic
1173029913 20:39347175-39347197 AAACCTGCTGATATTTGAAAGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1179280977 21:39934023-39934045 CAAGATGATGATATTGAAGTGGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180690111 22:17706988-17707010 GAAGCTTCTGATTTTAGAATAGG + Intronic
1183852839 22:40605936-40605958 CAAGAAGCTGATTGTGGAATAGG - Intronic
1185152493 22:49172405-49172427 CAAACTGCTGGTCTTGGAGTAGG + Intergenic
950170068 3:10832916-10832938 CAAGCTGCTGAAGTAGGAAGGGG + Intronic
951583909 3:24195757-24195779 CAAGATGCTGCTGTGGGAATGGG - Intronic
951805817 3:26642567-26642589 CAAGCTGCTGGTACAGGTATAGG + Intronic
956614204 3:71154820-71154842 CCAGCTGCTAGTAATGGAATTGG - Intronic
958076813 3:88690925-88690947 CAGGTTGCTGAAATTTGAATGGG - Intergenic
962447450 3:135479819-135479841 GAAGCTGCTGATTGTGGAGTTGG - Intergenic
964552022 3:157895609-157895631 TAAGCTGCTGATATTTGTACTGG - Intergenic
968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG + Intergenic
968955682 4:3717657-3717679 GAAGCTGCTGATTTAGAAATTGG - Intergenic
971099124 4:23442997-23443019 CCAGATGCTGAGATTGGATTAGG + Intergenic
971936018 4:33148559-33148581 AAAGCAGCTGAGATTTGAATAGG - Intergenic
972304075 4:37814970-37814992 CAAGATGATGATATTAGAAGTGG + Intergenic
974125131 4:57686879-57686901 AAAGCTGCTGATTATGGCATTGG + Intergenic
976830063 4:89305642-89305664 CAAGCTGCAGATTTTGCAACTGG + Intronic
977271262 4:94919748-94919770 CCAGCTCTTGATATGGGAATGGG + Intronic
977335911 4:95699322-95699344 CAAGGTGGTGGTATTAGAATAGG + Intergenic
978450297 4:108826015-108826037 AAAGATGCTGATTTTGAAATAGG - Intronic
979179608 4:117708363-117708385 GAAGTTGCTGATTTTTGAATGGG - Intergenic
979425295 4:120556916-120556938 CATGATCCAGATATTGGAATTGG + Intergenic
980159130 4:129138426-129138448 CAAGCTGCAGCTCTTGGAGTTGG + Intergenic
980919777 4:139071892-139071914 CTATCTGGTGATGTTGGAATAGG + Exonic
980930830 4:139180961-139180983 CAAGCTAATGATCATGGAATAGG + Intergenic
980958850 4:139454553-139454575 CACGCTGATGAGATTGGAGTTGG + Intronic
981260013 4:142708327-142708349 CAAGCTGCAGAAATTTGCATAGG + Intronic
981791895 4:148547174-148547196 CTAGCTGTGGATAATGGAATAGG + Intergenic
986017820 5:3773564-3773586 CAAGTTACTGTTATTTGAATAGG - Intergenic
986591325 5:9373840-9373862 CATGCTCCTGTTATAGGAATTGG - Intronic
990150742 5:52814654-52814676 TAAGCTCCTGATATTTGAACAGG + Intronic
990965184 5:61438830-61438852 CAACCTGCTGTTCTTGGAGTTGG - Intronic
991291000 5:65033986-65034008 CAAGCTGCTGATTGTGGCTTAGG + Intergenic
993253469 5:85557005-85557027 CAGGCTGCTGATCTTTGGATGGG - Intergenic
998186086 5:139981215-139981237 CAAGCTGCTCATTTGGGACTGGG + Intronic
998948957 5:147372388-147372410 CAAGTTCCTTATTTTGGAATAGG + Intronic
999034770 5:148335165-148335187 AAAAGTGCTGATTTTGGAATGGG - Intronic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000896549 5:166861977-166861999 CAAGCTGCTGAAATTTAAAATGG + Intergenic
1002566850 5:180116959-180116981 CAGTCTGCTGATCTGGGAATTGG + Intronic
1003185203 6:3824507-3824529 CAACGTGCTGAGTTTGGAATTGG - Intergenic
1003481226 6:6535129-6535151 AAAGCTGCTGAAACTGTAATTGG + Intergenic
1006791163 6:36702166-36702188 CAAGCTGCTGGGATAGGAAGGGG + Intronic
1009474925 6:64078779-64078801 CAAGCTGATGATAGTGCCATAGG - Intronic
1010134174 6:72531223-72531245 CAAAATGCTGATATTGTAACTGG + Intergenic
1013262920 6:108464118-108464140 CAAGCTGTTGATTTTTGAAAAGG + Intronic
1013905123 6:115207049-115207071 CAAGAAGCAGATATTAGAATCGG + Intergenic
1015136896 6:129882625-129882647 GAAGCTGCTGATCTTTGGATGGG + Intergenic
1017219735 6:151951979-151952001 CAAGCTGGTGACAGTGGAACAGG - Intronic
1017672128 6:156778327-156778349 CAAGCTGTTGTTGTTGGAAATGG - Exonic
1020719069 7:11718433-11718455 CAAGCTGCAAATATTTTAATAGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021682150 7:23144553-23144575 CAAACAGTTCATATTGGAATAGG - Intronic
1022843599 7:34189067-34189089 CAATCTGCTGAGATTGGAGGAGG - Intergenic
1023986636 7:45100969-45100991 CAAGCTGCTCATCTGTGAATGGG + Intronic
1026584886 7:71647995-71648017 GTAGCTGCTGATGTTGGCATAGG - Intronic
1027411674 7:77926499-77926521 TAATCTACTGATATTAGAATGGG - Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028407678 7:90493908-90493930 CAGGCTTCTGATTGTGGAATAGG + Intronic
1032534446 7:132650272-132650294 CAAGTTGCTGACGTTTGAATGGG - Intronic
1034692883 7:153028125-153028147 CAGGCTGCTGTGATTGGAACTGG + Intergenic
1035107270 7:156452316-156452338 CAAGGTGCTTATATTGTATTGGG - Intergenic
1036293063 8:7512076-7512098 CCATCTGCTGCTATTGGAATGGG - Intergenic
1036329498 8:7808924-7808946 CCATCTGCTGCTATTGGAATGGG + Intergenic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1037770610 8:21797043-21797065 GAAGCTGCTGATCTAGGACTGGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041391223 8:57349084-57349106 CAAGTAGCTGACATTGGAATTGG + Intergenic
1042381184 8:68116115-68116137 CAAGCTACTCATATTAGAAAAGG - Intronic
1042961078 8:74304141-74304163 CAAGGTGCTGATAATCCAATGGG + Intronic
1043225002 8:77715025-77715047 CAACATGATGATATTGGAAGTGG - Intergenic
1044533531 8:93334626-93334648 CAAGGGGCTGACATTGGAACTGG - Intergenic
1045439427 8:102194794-102194816 CAAGATTCTGATAATGGAAGAGG - Intergenic
1048673567 8:136751008-136751030 AAATCTGCTGATAGTAGAATTGG + Intergenic
1048693694 8:136998812-136998834 CATGATGCTGATAGTGGAAGAGG + Intergenic
1050008746 9:1163356-1163378 TAAACTGCTAATATTGGACTGGG + Intergenic
1050822421 9:9896413-9896435 CAAGCAGCTGAAACTGGAACAGG + Intronic
1052621836 9:30921675-30921697 TAAGCAGATGATATTTGAATTGG - Intergenic
1055977359 9:81968265-81968287 CAAGCTGTTGGTATGGGAAATGG - Intergenic
1057278379 9:93690007-93690029 GAATCTGCTGTTATTTGAATTGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1059935336 9:119304661-119304683 CAGGGTGCTGAAAATGGAATTGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1187704420 X:21995245-21995267 CAAGTTGCTCATATTGCCATAGG - Intergenic
1192820104 X:74636485-74636507 CAAACTGCAGAAATGGGAATGGG + Intergenic
1198608173 X:138367669-138367691 AAAGATACTGATATTGGAGTTGG + Intergenic
1199006516 X:142704770-142704792 CAACCTGCTGATATTTTCATTGG - Intergenic
1201528960 Y:14970779-14970801 AAAGCTGCTGACACTGGACTGGG + Intergenic