ID: 1000382597

View in Genome Browser
Species Human (GRCh38)
Location 5:160642480-160642502
Sequence AGACGTTGCCAAATGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2421
Summary {0: 1, 1: 50, 2: 320, 3: 772, 4: 1278}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000382597_1000382606 28 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382606 5:160642531-160642553 GGGGGTGCTAATGCATCTTGTGG No data
1000382597_1000382602 7 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382602 5:160642510-160642532 TTTGGGTTATCTCACTTGGTGGG No data
1000382597_1000382603 8 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382603 5:160642511-160642533 TTGGGTTATCTCACTTGGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1000382597_1000382604 9 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382604 5:160642512-160642534 TGGGTTATCTCACTTGGTGGGGG 0: 1
1: 0
2: 2
3: 12
4: 129
1000382597_1000382607 29 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG 0: 1
1: 0
2: 2
3: 5
4: 79
1000382597_1000382601 6 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382601 5:160642509-160642531 ATTTGGGTTATCTCACTTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 201
1000382597_1000382600 3 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382600 5:160642506-160642528 GAAATTTGGGTTATCTCACTTGG No data
1000382597_1000382599 -10 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382599 5:160642493-160642515 GGCAACGTCTTGAGAAATTTGGG 0: 1
1: 1
2: 9
3: 90
4: 280
1000382597_1000382605 10 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382605 5:160642513-160642535 GGGTTATCTCACTTGGTGGGGGG 0: 1
1: 0
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000382597 Original CRISPR AGACGTTGCCAAATGTCCTC TGG (reversed) Intronic
Too many off-targets to display for this crispr