ID: 1000382607

View in Genome Browser
Species Human (GRCh38)
Location 5:160642532-160642554
Sequence GGGGTGCTAATGCATCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000382597_1000382607 29 Left 1000382597 5:160642480-160642502 CCAGAGGACATTTGGCAACGTCT 0: 1
1: 50
2: 320
3: 772
4: 1278
Right 1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG 0: 1
1: 0
2: 2
3: 5
4: 79
1000382596_1000382607 30 Left 1000382596 5:160642479-160642501 CCCAGAGGACATTTGGCAACGTC 0: 1
1: 41
2: 270
3: 709
4: 1198
Right 1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG 0: 1
1: 0
2: 2
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000382607 Original CRISPR GGGGTGCTAATGCATCTTGT GGG Intronic
900579515 1:3402173-3402195 GGGGGGATGAGGCATCTTGTTGG + Intronic
904278280 1:29398495-29398517 GGGGTGCTACCGTACCTTGTGGG - Intergenic
904287740 1:29462831-29462853 GAGTTGCTATTGCATCCTGTAGG + Intergenic
905004584 1:34699479-34699501 GGGGTGTTAATGAACCCTGTTGG - Intergenic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
907648078 1:56264269-56264291 GTGCTGCTAATTCATTTTGTAGG + Intergenic
910966966 1:92817715-92817737 GGGGTGCTAATGAAGACTGTAGG + Intergenic
911084732 1:93966849-93966871 CTGCTGCTAATGCCTCTTGTAGG + Intergenic
913470380 1:119180379-119180401 GGGGTCCTAATGTGTCTGGTTGG - Intergenic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
916651830 1:166840155-166840177 GGAGTGCGGATGCATCTTGAGGG - Exonic
917663271 1:177198511-177198533 TGGGTACTAATGAATCATGTGGG + Intronic
918854360 1:189731583-189731605 GGAGTTCTAATGCATTTTCTTGG - Intergenic
922093315 1:222418523-222418545 TGGGTTCTAAGGCATTTTGTAGG + Intergenic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922177878 1:223211183-223211205 GAGGTACTATTGCATCTTGTGGG - Intergenic
1070404621 10:76083851-76083873 GGGGCTCTAGTGCATCTTGTGGG + Intronic
1070618247 10:77986042-77986064 GGGGTTCTAACGCGTCTTGGAGG + Intronic
1071507425 10:86241135-86241157 TGGGAGCTGGTGCATCTTGTGGG - Intronic
1071548661 10:86548856-86548878 GGGGTGCTGGTCCATCTTGAGGG - Intergenic
1073457693 10:103647481-103647503 GTGGAGCTAGAGCATCTTGTTGG - Intronic
1074463352 10:113659302-113659324 GGGGTATTATTGCATCTGGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1077517734 11:3012013-3012035 GTGGTACTAATGCACCTGGTGGG + Intronic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1083432172 11:62619339-62619361 AGGGTGTTAATACATCTTCTGGG - Intronic
1086611195 11:88757810-88757832 GAGGTGCCAAAGCATTTTGTAGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1092145605 12:6212559-6212581 GGGGTGCTAGTGCAGCTGGGGGG - Intronic
1093249420 12:16782621-16782643 GGGGTGCAACTGCTTCTTGATGG - Intergenic
1098446789 12:70574272-70574294 AGGATGCTAATGCAACTTGCAGG - Intronic
1104144687 12:126021439-126021461 TGGATGCAAATGCTTCTTGTGGG - Intergenic
1105214178 13:18274702-18274724 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG + Intronic
1111645164 13:91023209-91023231 GGGGTTGTAATGCAGCATGTGGG - Intergenic
1113648134 13:112013210-112013232 GGGGTCCTAATGCTTTATGTAGG + Intergenic
1118670749 14:68123985-68124007 AGGGAGCTAATGCATCATTTTGG - Intronic
1119209162 14:72817058-72817080 GTGGTGCTTTTGCATCATGTAGG - Intronic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1135171341 16:20186712-20186734 GGGGTCCTAATGCTTCAGGTTGG + Intergenic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG + Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1162867097 19:13556406-13556428 GGGGTGCCAAGGCACCTTGCTGG + Intronic
928995247 2:37282746-37282768 GGGGTGCTAAAGTGACTTGTAGG - Intronic
934300141 2:91772048-91772070 GGGGTGCTAATGTTTCTGGATGG + Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
937690041 2:124745103-124745125 GGGCTGCTAATGGAACTTCTAGG + Intronic
940031122 2:149262477-149262499 GAGGTTCTAATACATTTTGTAGG + Intergenic
1171521767 20:25781589-25781611 GGGCTTCTAACACATCTTGTAGG - Intronic
1171555074 20:26074462-26074484 GGGCTTCTAACACATCTTGTAGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1181555881 22:23671475-23671497 GGGGTGCTAATGTTTCTGGATGG - Intergenic
1181698496 22:24607178-24607200 GGGGTGCTAATGTTTCTGGATGG + Intronic
1183193849 22:36339665-36339687 GTGGTGGTAATGCATCTTGTTGG - Intronic
952315855 3:32231727-32231749 CTGGTCATAATGCATCTTGTTGG + Intergenic
952717231 3:36492304-36492326 GGTGTGCTAAAGCATCTTTGTGG - Intronic
955370907 3:58350983-58351005 GGGCTGCTAAAGCATTTAGTGGG - Intronic
959050710 3:101522494-101522516 GGGGTGTTGCTGCATCTTTTTGG - Intergenic
963690315 3:148491888-148491910 TTGGTTCAAATGCATCTTGTTGG + Intergenic
970076329 4:12225317-12225339 AGGGTGTTAATGAATGTTGTGGG + Intergenic
970340627 4:15103178-15103200 GAGATGCTAATGCATGTGGTTGG - Intergenic
984486580 4:180377743-180377765 GAGGTGCTGATGGAACTTGTTGG - Intergenic
990204493 5:53414244-53414266 GCTGTTCTAATGCTTCTTGTTGG - Intergenic
995640109 5:114246285-114246307 GGGATGATTATGCATCTTATTGG + Intergenic
995913062 5:117211093-117211115 TGAGAGCTAATGCCTCTTGTGGG - Intergenic
997389004 5:133498066-133498088 GGGGTGCTAAAGAATATTATGGG - Intronic
999285910 5:150394099-150394121 GTGGTGCTGATGCACCTGGTAGG + Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1005148169 6:22716476-22716498 GGGATGATAGTGCAACTTGTGGG + Intergenic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1018867476 6:167757534-167757556 GGGGTGAGAATGCATTCTGTTGG - Intergenic
1022953930 7:35364216-35364238 GGGATGCTGATGCTTCTGGTTGG + Intergenic
1023202076 7:37709476-37709498 GGGGTGGTAATCCCTCTTCTAGG - Intronic
1023468895 7:40491499-40491521 GGGATGCTAATGCATCTGAATGG + Intronic
1024800954 7:53077357-53077379 GGGCTGTTGATACATCTTGTTGG + Intergenic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1042386050 8:68175746-68175768 TGGCTGCTAATGCATTTTGATGG - Intronic
1047537584 8:125733774-125733796 GGGATGCTAATGCCTCTTTAGGG + Intergenic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1056449419 9:86701456-86701478 GGGGTGCAGAAGCACCTTGTTGG + Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1201920563 Y:19229342-19229364 GTGGTGCTATTGCAGCTTGCTGG - Intergenic