ID: 1000387799

View in Genome Browser
Species Human (GRCh38)
Location 5:160691712-160691734
Sequence TATGAGAAGAATTATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000387799_1000387802 27 Left 1000387799 5:160691712-160691734 CCCTCATCATAATTCTTCTCATA 0: 1
1: 1
2: 2
3: 36
4: 368
Right 1000387802 5:160691762-160691784 TCCACAGACCCCAAGCCTGCAGG 0: 1
1: 0
2: 1
3: 32
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000387799 Original CRISPR TATGAGAAGAATTATGATGA GGG (reversed) Intronic
901579455 1:10229005-10229027 CATGAGGAGAGTTAAGATGATGG + Intronic
903255283 1:22093960-22093982 TATCAGAAGAACAAGGATGATGG + Intergenic
904123813 1:28222130-28222152 GATGAAAAGAGTTATGAGGATGG + Intronic
904439282 1:30519514-30519536 TATGGGGAAGATTATGATGATGG + Intergenic
904439296 1:30519687-30519709 TATGGGGAAGATTATGATGATGG + Intergenic
904441717 1:30536042-30536064 GATGAGATGAATTGTGATGGAGG + Intergenic
904714416 1:32456536-32456558 TATGACAAGAATAAAAATGAAGG + Intergenic
907853820 1:58281943-58281965 GATGATAACAATGATGATGACGG - Intronic
908322157 1:62988771-62988793 TCTGAGTAGACTCATGATGAAGG - Intergenic
908798470 1:67854647-67854669 TATGAGAAGAATGGAGAGGAGGG + Intergenic
909568233 1:77079542-77079564 GATGAGAAGAATTCTGACCATGG + Intergenic
909850008 1:80449485-80449507 TATGAGGATAATTATAATAATGG + Intergenic
910489629 1:87754833-87754855 TATGAGAAGAAAGATGCTAAAGG + Intergenic
911200554 1:95039378-95039400 CATCAGAAGAATGATGCTGAAGG + Intronic
911365571 1:96933481-96933503 GTTCAGAAGAATTGTGATGAAGG + Intergenic
911572115 1:99530000-99530022 TATGATAAGAATTTTCATAAAGG - Intergenic
911627566 1:100142443-100142465 TATGAGAAATATTAAGATGTTGG + Intronic
912248897 1:107990733-107990755 TATGAGAGGCATTATGAGCAAGG + Intergenic
912310418 1:108615376-108615398 TATGGGAATAATAATGATAATGG - Intronic
912635911 1:111292678-111292700 GATGAAAAGAATTATGGAGATGG - Intronic
913571284 1:120122507-120122529 TTTTAGAAGTATTATGATGAAGG + Intergenic
914242478 1:145860964-145860986 TATGAGGAGGATTATACTGAAGG - Intergenic
914292095 1:146283484-146283506 TTTTAGAAGTATTATGATGAAGG + Intergenic
914553139 1:148734267-148734289 TTTTAGAAGTATTATGATGAAGG + Intergenic
916023982 1:160818421-160818443 TCTGAGAAGAAATAAGATGCTGG - Intronic
916813329 1:168325757-168325779 TACAAGAAGAATTATGTGGAAGG - Intergenic
917148328 1:171916938-171916960 TCTGAGAAGAAATATGAGGTAGG - Intronic
918147777 1:181772703-181772725 TAAGAGTAGAATGATGATAATGG + Intronic
918521253 1:185417361-185417383 TATAAGATGAATTAGGATGTTGG + Intergenic
918641307 1:186844384-186844406 CATTATAAGAATGATGATGATGG + Intronic
918754925 1:188327790-188327812 TATGATAAGAACTGTGATTATGG - Intergenic
919159802 1:193814133-193814155 TATGAGAAAAAATAAGATCAAGG - Intergenic
919439850 1:197618592-197618614 CATTAAAAGAATTCTGATGAGGG - Intronic
919687284 1:200495973-200495995 AATGAGAAGGATTCTGATAAGGG - Intergenic
921421110 1:214949444-214949466 TCTGAGAAGGATTATGAAGAGGG + Intergenic
922149896 1:222991012-222991034 TATGAGAATAATTTTGTAGAAGG - Intronic
923164648 1:231348275-231348297 TCAAAGAAGAATTCTGATGAGGG - Intronic
923950163 1:238941561-238941583 TCTTAGAAGAATTATGATCTTGG + Intergenic
924697688 1:246417775-246417797 TAAGATTAGAATTATGATAAGGG - Intronic
924837446 1:247666666-247666688 TATTTGAAGAAATATGATGGAGG + Intergenic
1063793009 10:9476814-9476836 TATAAGCAGTATTATGATAAAGG + Intergenic
1066237715 10:33502503-33502525 TACGAGATGAACTATGAGGAGGG - Intergenic
1066984977 10:42456817-42456839 TAAAAGAAGAATAATGATAAAGG + Intergenic
1068796652 10:61089631-61089653 TAAGAGAACAAATATGATGGAGG - Intergenic
1069366453 10:67699268-67699290 TTTGGGAAGTATTATGATGAAGG - Intergenic
1069792646 10:71032895-71032917 GATGATAACAATGATGATGATGG + Intergenic
1070082553 10:73203259-73203281 TATGAGCAGAATTATTCTGTGGG - Intronic
1070431543 10:76344590-76344612 TTTAAAAAGAATTATAATGAGGG + Intronic
1070502541 10:77085063-77085085 GATAGGAAGAATTAGGATGATGG - Intronic
1072110198 10:92312283-92312305 TATGAGAAGATTAATAATAAGGG + Intronic
1073835156 10:107432770-107432792 GATGAAAATAATAATGATGACGG - Intergenic
1073955155 10:108862160-108862182 TAAGAGTACATTTATGATGATGG + Intergenic
1074294945 10:112177233-112177255 TATGAGAAGTAATATCATAAGGG + Intronic
1075934129 10:126325138-126325160 TATGAGAAGAAACATGAGAACGG + Intronic
1075976656 10:126701930-126701952 TATGACAATGATTGTGATGATGG + Intergenic
1078278700 11:9877205-9877227 TATGACAACAATGATGATCAAGG + Intronic
1078297645 11:10090165-10090187 TATGAGAGGATGAATGATGAGGG + Intronic
1078487631 11:11738712-11738734 TATGAGAAGAAGTCTAATGGGGG - Intergenic
1079362581 11:19781509-19781531 ATTGAGAATAATGATGATGAGGG + Intronic
1079963609 11:26953537-26953559 TATAAGAAGAGCTATGATGGGGG - Intergenic
1080421394 11:32114124-32114146 TATGAGTAGAATTATTAGGTTGG - Intergenic
1080695417 11:34599630-34599652 TTTCAGAAGAATTATGACTATGG - Intergenic
1084443386 11:69189117-69189139 TATGACGACAATGATGATGATGG - Intergenic
1084443397 11:69189222-69189244 TATGATGACAATGATGATGATGG - Intergenic
1084896700 11:72276613-72276635 GATGAAAAGAATTATGAAGATGG - Intergenic
1085131011 11:74038600-74038622 TATCAGCAGAAGTATGAGGAAGG - Intronic
1085997723 11:81941096-81941118 AATGAGGATAATAATGATGATGG + Intergenic
1087845172 11:102964417-102964439 TAAGAGAAAAATTATGATTATGG + Intergenic
1088002718 11:104901717-104901739 TGGAAGAAGAATCATGATGAGGG - Intergenic
1088006156 11:104943034-104943056 TGCAAGAAGAATCATGATGAGGG - Intronic
1088042628 11:105406244-105406266 TTGGAGAAAAATTAAGATGAAGG + Intergenic
1089069039 11:115684529-115684551 CAGGAGAGAAATTATGATGAGGG + Intergenic
1089428311 11:118399706-118399728 TATGAGAAGGAATTTGAGGAAGG - Intronic
1089429494 11:118410876-118410898 TGTGAGAAGTACTATAATGAGGG + Intronic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090870372 11:130739392-130739414 TATGAGAAGCTTTTTCATGATGG + Intergenic
1092507101 12:9113613-9113635 GATGATGATAATTATGATGATGG - Intronic
1092685389 12:11038518-11038540 TATGAGAAGAATTATCAAGATGG - Intronic
1092687543 12:11068351-11068373 TGTGAGAGGAATTATCAAGATGG - Intronic
1092690518 12:11104428-11104450 TGTGAGAGGAATTATCAAGATGG - Intronic
1093834945 12:23817244-23817266 TATGATAAGAATAATAATAATGG - Intronic
1094167205 12:27454971-27454993 GATTAAAAGAATTATGATAATGG - Intergenic
1095166089 12:38973757-38973779 AAAGAGAATAATTATAATGATGG - Intergenic
1095375822 12:41527388-41527410 TATTAGAAGAAGTGTGATGGAGG + Intronic
1095471270 12:42539588-42539610 TATGAGCACAATTCTTATGATGG + Intronic
1095859587 12:46901792-46901814 TATGCTGAGATTTATGATGAAGG - Intergenic
1096310700 12:50518041-50518063 TATTAGCATAATGATGATGAGGG + Intronic
1097396602 12:59082723-59082745 TATGACAAGGATTATGAGTAGGG - Intergenic
1097673974 12:62577070-62577092 TATTAAAAGATTTGTGATGATGG - Intronic
1097791788 12:63822899-63822921 TATGTGAAAAATCTTGATGATGG + Intergenic
1098773094 12:74579687-74579709 GATGAGAAAAATAATGGTGATGG - Intergenic
1099156846 12:79187905-79187927 AATGAGAAGAATTGGGAGGAAGG - Intronic
1099476165 12:83109706-83109728 TAAGAGAGCAATTATAATGATGG - Intronic
1099590549 12:84582567-84582589 TTAGAGAAAAATTATGAAGATGG - Intergenic
1099659299 12:85534846-85534868 TATGAGAACACTAATCATGAGGG - Intergenic
1099908373 12:88799340-88799362 TATGAGAAAAAAGATGATAAGGG - Intergenic
1100304902 12:93341380-93341402 TTTTAGAAAGATTATGATGATGG - Intergenic
1100459366 12:94783729-94783751 TATGTGAAGAACAATGCTGAAGG + Intergenic
1100838156 12:98586623-98586645 TATGAAAAGGGTTATCATGAGGG + Intergenic
1101190545 12:102328020-102328042 TGTGATAAGTATTATGATGAAGG + Intergenic
1104130093 12:125885119-125885141 AATGACAATAATGATGATGACGG - Intergenic
1105935779 13:25097087-25097109 TATGTGAAAAATCTTGATGATGG + Exonic
1106414289 13:29533469-29533491 TGAGAGAAGAATTATGGTGCAGG - Intronic
1106658202 13:31769992-31770014 TATCTGAAGGATGATGATGAAGG - Intronic
1106976097 13:35217839-35217861 TTTGAAAAGAATAATTATGAAGG - Intronic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1107277303 13:38690926-38690948 TATGAGAGAATTTATGGTGATGG + Exonic
1107478205 13:40761755-40761777 TCAGAAAAGAATTCTGATGAGGG + Intronic
1107773520 13:43813283-43813305 TCTGAAAAGCATTATAATGATGG + Intergenic
1109103020 13:58210459-58210481 CATAAAAAGAATTATTATGAGGG - Intergenic
1110199953 13:72838274-72838296 TATCATAAGTATGATGATGATGG + Intronic
1111552053 13:89826198-89826220 TATGAGAAAAAATATGATACTGG - Intergenic
1111652372 13:91108173-91108195 CTTGAGAAGAATTCTGATGCCGG + Intergenic
1112236301 13:97640917-97640939 CATGAGAAAAAGTAGGATGATGG - Intergenic
1112543807 13:100344188-100344210 TATGAGAAGTGTTAAGATGATGG + Intronic
1112651145 13:101399964-101399986 TGTGAGAAGAATTGTTATAAAGG + Intronic
1112661912 13:101519801-101519823 GATGATAATGATTATGATGATGG + Intronic
1113357770 13:109599713-109599735 AATGAGAACATTTATGATGTGGG + Intergenic
1114346590 14:21802407-21802429 TTTGAGAAGTATTGTGATAATGG + Intergenic
1114937537 14:27561056-27561078 TATGAAAAATATTATGATTATGG - Intergenic
1115890463 14:38021883-38021905 TATGACAAAAATCGTGATGATGG + Intronic
1116013128 14:39374462-39374484 TTTGAGAACAGATATGATGATGG + Intronic
1117989021 14:61415775-61415797 TATGAAAAGAATTCTGGAGATGG - Intronic
1119056180 14:71422412-71422434 AATGAAAAGAGTTATGAAGATGG - Intronic
1119586134 14:75837533-75837555 GATGAAAAGAATTATGGAGATGG - Intronic
1119637041 14:76281975-76281997 AATGAAAAGCATTATGAAGATGG + Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1124141663 15:27082497-27082519 TATGAGAGGAATCATGACAAGGG + Intronic
1125064295 15:35463288-35463310 TATGAGAATAAACATCATGAAGG - Intronic
1126421705 15:48480519-48480541 TATGAGAAGAAGCATGAAGCTGG - Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1129017607 15:72482309-72482331 TATGAGAAGACTTATTCTTAAGG + Intronic
1129496799 15:75990583-75990605 TATCAGAAGAATTATAATAGAGG - Intronic
1130311185 15:82756384-82756406 GATGAGAAGTATTAAGAAGAAGG + Exonic
1131643682 15:94319178-94319200 TATCACAAGTATTAAGATGAAGG + Intronic
1133430293 16:5731083-5731105 TATGAGGACAATGATGTTGATGG - Intergenic
1133815145 16:9191458-9191480 GGTGACAATAATTATGATGATGG + Intergenic
1133838874 16:9390520-9390542 TATGACATGAAATATTATGATGG - Intergenic
1136959137 16:34825636-34825658 GATGAAAAGAATTATGGAGATGG + Intergenic
1138301939 16:55937735-55937757 AAAGAGAAGAATTATGAAGAAGG - Intronic
1138841422 16:60512575-60512597 TAATAGAAGGATTATGAAGAGGG + Intergenic
1139873232 16:70124445-70124467 TATGAGAACAATAGTGAAGATGG - Intronic
1140157202 16:72443526-72443548 TATGGGAAGAATATTGATCAAGG - Intergenic
1141751780 16:85963005-85963027 GGAGAGAAGAATGATGATGAAGG + Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1145071797 17:19816314-19816336 TATGGGAAGAATTTTCATAAAGG - Intronic
1146503480 17:33384449-33384471 TATGGGAGGGATTATGATGTCGG + Intronic
1146555559 17:33820490-33820512 TGTGAAAAGAAATATCATGATGG + Intronic
1149286143 17:55166562-55166584 TATGAGAAGAAATCTGATGCAGG - Intergenic
1149562293 17:57617212-57617234 TATGAGGAGAATTAACATCATGG - Intronic
1150477379 17:65485388-65485410 AATGAGTACAATTATTATGATGG - Intergenic
1150865257 17:68842472-68842494 TGTGAGAAGAGGTATGATTATGG + Intergenic
1153518472 18:5928472-5928494 TATAAGACGAATTACAATGATGG + Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1156741117 18:40329674-40329696 TATAAGATGAAAAATGATGATGG - Intergenic
1156822276 18:41387506-41387528 TTTAAGAAGAATTCTGATCAGGG - Intergenic
1157001524 18:43531997-43532019 CATGATAACAATTATGATGAAGG + Intergenic
1157326690 18:46674295-46674317 GATGAGCAGGATTATAATGAGGG + Intronic
1158218080 18:55121449-55121471 TATGCTCAGAAGTATGATGAAGG - Intergenic
1158738382 18:60110412-60110434 TATGACAAGAATAATGATGCTGG - Intergenic
1159923111 18:74244122-74244144 TCTGAAATGAATTATGGTGATGG - Intergenic
1160271761 18:77393162-77393184 AATGAGATGAGTTATCATGAGGG + Intergenic
1160676847 19:395554-395576 GATGGGAAGAATTATGGAGAAGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1162182719 19:8881630-8881652 TATGACAATAATGATGGTGATGG - Intronic
1162183572 19:8887520-8887542 AATGAGAATAATGATGATGATGG - Intronic
1162291151 19:9781484-9781506 TATGACAAGACTTATAATAAAGG - Intronic
1162521567 19:11183397-11183419 ACTGTGAAGAATTAAGATGAAGG + Intronic
1165542642 19:36504878-36504900 GATGAAAAGAATTATAAAGATGG - Intergenic
1166147347 19:40846754-40846776 TGTGAGGATTATTATGATGAGGG + Intronic
1166151496 19:40878639-40878661 TGTGAGGATTATTATGATGAGGG + Intronic
1166879746 19:45920543-45920565 CATGAGGACAATGATGATGATGG - Intergenic
925094998 2:1191192-1191214 TATGAAAAGAGATATGATAAGGG - Intronic
925330864 2:3057692-3057714 GAAGACAAGGATTATGATGATGG + Intergenic
925330875 2:3057776-3057798 GAAGACAAGGATTATGATGATGG + Intergenic
925811699 2:7707747-7707769 TTAGAAAAGCATTATGATGAAGG - Intergenic
925839243 2:7975575-7975597 CATGAGAAAATTCATGATGAAGG + Intergenic
928041782 2:27885323-27885345 TATGAGAATAAATAGCATGAAGG - Intronic
928136849 2:28694230-28694252 AAAGAGAAGAATTATAATCAGGG + Intergenic
929129519 2:38553387-38553409 TATGAACAGCAATATGATGAGGG + Intergenic
930225890 2:48792658-48792680 TAGGAGAAGAAAGATGATGATGG - Intergenic
930451522 2:51544581-51544603 CATGAGAAAAATATTGATGAGGG + Intergenic
932011957 2:67987640-67987662 TCAGAGAAGGATTATGAAGAGGG + Intergenic
932073084 2:68640329-68640351 AATGAAAATAATTATGAAGATGG - Intergenic
932581464 2:72995029-72995051 TATAATCAGAATTATGATGAAGG - Intronic
934042377 2:88138464-88138486 TATGGGAAGCATCCTGATGAAGG - Intergenic
935252867 2:101280244-101280266 TAAAAGAAGAATAAAGATGAAGG + Intronic
935808996 2:106776953-106776975 GGTAAGAAGAACTATGATGATGG - Intergenic
936510648 2:113142574-113142596 TCTGAGAAGTATTATGATCTTGG - Intergenic
936744770 2:115561579-115561601 TATGAGAAGTATTTAAATGAAGG + Intronic
937471782 2:122180149-122180171 TATAATAAGTATAATGATGATGG - Intergenic
938119037 2:128620960-128620982 GATGAGAGGAATTTTGATCATGG + Intergenic
938410307 2:131058323-131058345 TATGAGAAGGCTGATGTTGAAGG - Intronic
939251119 2:139682763-139682785 TGAGAGAAGAATTCTGTTGAGGG - Intergenic
939276156 2:139999043-139999065 GAGGAGAAGAAATATTATGAAGG - Intergenic
939605300 2:144247294-144247316 TATAGGAAGAATTATTAAGAGGG + Intronic
939778975 2:146420935-146420957 TATGTGAAGGAGTATGATGATGG + Intergenic
940042487 2:149375156-149375178 TATGAGTAGATTTATTCTGAAGG + Intronic
940397976 2:153214435-153214457 TGCAAAAAGAATTATGATGATGG - Intergenic
941132281 2:161667419-161667441 TATGATAAGACCTATGAAGAAGG + Intronic
943013575 2:182482359-182482381 TATAAGAAAAAATATGATTATGG + Intronic
943379008 2:187119849-187119871 TGTGAGAAGTATTAGGATGATGG + Intergenic
944375753 2:199039600-199039622 TATGACAAAAATAATAATGATGG + Intergenic
944516244 2:200514600-200514622 TATCAGAAGTATGAGGATGAGGG + Intronic
944963997 2:204908178-204908200 TAAGAGAATAATGATAATGAAGG + Intronic
947311882 2:228812267-228812289 TTTGAGAATTATTATTATGAAGG + Intergenic
948331726 2:237172823-237172845 GATGAAAAGAGTTATGATGATGG - Intergenic
1169024780 20:2360523-2360545 TTTGAGATGAATGATGGTGATGG - Intergenic
1173426946 20:42951441-42951463 TCTTAGAAAAATTATGCTGATGG - Intronic
1173588054 20:44199640-44199662 TATGTGAAAAATTGTGAAGAAGG + Intronic
1175574091 20:60047493-60047515 TATGATAATAATAATGATGATGG + Intergenic
1178589112 21:33894323-33894345 TGTCAGAAAAATTATGATGTGGG - Exonic
1179256670 21:39722405-39722427 TATGAGCAGAAATATTATGGGGG + Intergenic
1181718024 22:24749275-24749297 AATGGGAAGAATTTTGATGTTGG - Intronic
1183340439 22:37277603-37277625 AAAGAGAAGAATTACGATGTAGG - Intergenic
1184526074 22:45023722-45023744 TTTGTGAAGGATTAAGATGAGGG - Intergenic
1185201060 22:49505557-49505579 TATGACAAAAATGATGATGGTGG + Intronic
949389821 3:3547264-3547286 AAAGAGAAAAATAATGATGAGGG - Intergenic
949693729 3:6669422-6669444 TAAGAAAAAAATTATGATCAGGG - Intergenic
949783945 3:7719934-7719956 TTTGATAATAATTATGATGGTGG + Intronic
951020057 3:17773594-17773616 TTTTAGCAGAATAATGATGATGG - Intronic
951476441 3:23111463-23111485 TATGAAAAGAATTCTGCTGGGGG + Intergenic
952007719 3:28861325-28861347 TGTGATAAGAATTTTGATAAGGG + Intergenic
953180734 3:40592151-40592173 TATGAAAAGAAGTAAGATGCAGG - Intergenic
954166553 3:48763787-48763809 TATGATAAGCACTATAATGAAGG - Intronic
955585986 3:60478546-60478568 TATGAGAAGAGTAACGATCATGG + Intronic
956310067 3:67869078-67869100 AATGAGGAGAGTTTTGATGAGGG - Intergenic
956890416 3:73607698-73607720 GATTGGAAGAAGTATGATGAAGG - Intronic
956952494 3:74298552-74298574 TATGAGAAGAAATATTAAAATGG + Intronic
957359644 3:79137625-79137647 GATGAGAATCATGATGATGATGG - Intronic
957946520 3:87070032-87070054 TGAGAGAAGAATCATGATGCAGG + Intergenic
959498014 3:107073634-107073656 TATGAGAAGAATTGTACTCATGG + Intergenic
960374465 3:116881443-116881465 TACTAGAACAATTATGATTAAGG - Intronic
962199700 3:133391158-133391180 TTTTAGAAGGATTATGCTGATGG + Intronic
962760044 3:138503121-138503143 GATGAAAAGAATTATGGAGATGG - Intronic
963305031 3:143641717-143641739 TTTGAGAAGCATTCTGGTGAAGG + Intronic
963399740 3:144782810-144782832 TTTGAGAAGAATTATGAATGAGG + Intergenic
963461986 3:145626304-145626326 TATAAGAAGTATTCTGATCATGG - Intergenic
963474724 3:145790575-145790597 AATGAGAAGAATTCTGAGCACGG + Intergenic
964407161 3:156361139-156361161 GATGAGAAGAATGATGAGGGCGG - Intronic
965177662 3:165356438-165356460 TAAGGGAAGAATTAAGAGGAGGG - Intergenic
965184035 3:165439819-165439841 GATGAGAAGAATGAGGAAGAAGG + Intergenic
965949102 3:174281962-174281984 GATGAGAAGAATTTTAATTACGG - Exonic
966598685 3:181752440-181752462 TCTAGGAAGAATTATGATGGCGG + Intergenic
967551864 3:190805303-190805325 TATATGAAGAATTAAAATGATGG + Intergenic
967611964 3:191517223-191517245 GATTAGAAGAAATATTATGAGGG - Intergenic
967803418 3:193690244-193690266 TATGATAATAGTTATTATGAAGG - Intronic
967973797 3:195019446-195019468 TATGGGAGTAATTATGATGGAGG - Intergenic
968697427 4:2039909-2039931 TATGAGAAAAATTATAAGAAAGG + Intronic
968875415 4:3264584-3264606 GATGAGAAGAATTCTGTGGAGGG - Intronic
969101326 4:4770720-4770742 GATGATAATGATTATGATGATGG - Intergenic
969234684 4:5857363-5857385 TATGAAAAGGATGGTGATGATGG - Intronic
969943226 4:10756100-10756122 AATGAAATGAATTATGAGGATGG - Intergenic
970253157 4:14137793-14137815 TATAGGAAGACTTATGATGAAGG + Intergenic
970297532 4:14646679-14646701 CATGACAATAATTATAATGATGG - Intergenic
970693892 4:18652931-18652953 TATGAGAAGAATTTAGAGGCAGG + Intergenic
970881710 4:20939939-20939961 TATGAGAAGAATAAGGCTCAAGG - Intronic
971188185 4:24401359-24401381 TATGACAGTAATTATTATGATGG + Intergenic
971599518 4:28574230-28574252 TATGAGAATAATTAAGAGAAAGG + Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
971993551 4:33933227-33933249 TGTGAGTAAATTTATGATGAAGG + Intergenic
972247636 4:37262139-37262161 TATGATAAGAAATAAGATCAAGG + Intronic
972961206 4:44454387-44454409 TATGATTAGAATTTTTATGATGG - Intergenic
972974680 4:44619560-44619582 TATGAGAAGAATTCTAAGGTAGG - Intergenic
974281391 4:59798941-59798963 TCTGTGAAGAATGATGATGATGG + Intergenic
974570301 4:63637668-63637690 TATGAGAAGATTTCTGTGGAAGG - Intergenic
974898217 4:67965234-67965256 TAGGAGAAAAATTATGCTCAAGG - Intergenic
975065744 4:70061522-70061544 TTTGAGAAGACTCATCATGAAGG - Intergenic
975332689 4:73135870-73135892 CATGTGAAGAATTATTCTGAGGG + Intronic
975568309 4:75784484-75784506 TATGTAAAGAATTATTCTGAAGG + Intronic
975682680 4:76892416-76892438 TATTGTAAGAATTCTGATGAAGG + Intergenic
975961560 4:79914098-79914120 TATGAGGAGAATTATCATTTTGG + Intronic
976177060 4:82365390-82365412 TTTTAGAAGAATAATTATGATGG - Intronic
977819968 4:101459742-101459764 TTTGTGAAGAATTTTGTTGATGG - Intronic
979535397 4:121813948-121813970 TCTGAGAAGGAAGATGATGAAGG + Exonic
980269493 4:130565278-130565300 TAGGTGAAGATTTCTGATGAGGG + Intergenic
980441720 4:132856502-132856524 TATGAAAAGACTTATGGAGATGG + Intergenic
981173136 4:141647933-141647955 GATGAGAAGAATTGTGATGGTGG + Intronic
982869237 4:160555090-160555112 TATGTGAAAAATTAACATGATGG - Intergenic
982985586 4:162202224-162202246 TATGAAAAGTATTATGAAGGAGG - Intergenic
983005532 4:162479964-162479986 TATGAGAAGTCATGTGATGAAGG + Intergenic
983842148 4:172470454-172470476 TTTGAGTAGAATTGTGCTGATGG - Intronic
984146206 4:176064732-176064754 TATGAGATGATTTCAGATGAGGG - Intergenic
986074293 5:4318600-4318622 TATCAGAAGAATAATTCTGAAGG - Intergenic
986453118 5:7886309-7886331 TTTGAGAAGAATAATGCTAATGG + Intronic
987555914 5:19448249-19448271 TCTGAGAAGAACTAAGATCAAGG + Intergenic
987840642 5:23218950-23218972 TATGAGAATAAATATGGTTAGGG + Intergenic
988234913 5:28529576-28529598 TTTGAGATGAATTATAATTAAGG + Intergenic
989433752 5:41386227-41386249 TATGAGAAAAATTTTAAAGATGG + Intronic
989514199 5:42322764-42322786 TTTGAGAAAAGTTATGATGATGG - Intergenic
990035528 5:51313331-51313353 TATCAGCAGCATTTTGATGAAGG + Intergenic
990773538 5:59278592-59278614 TATGGAAAGAATTATGAAGGTGG - Intronic
991407332 5:66313152-66313174 TAATAGTAGAATTATGAGGAAGG - Intergenic
992018640 5:72600420-72600442 CATGAGAATAATTTTGATGCTGG - Intergenic
992065720 5:73106025-73106047 GATGAAAAGAATTATGAAGATGG - Intergenic
992201833 5:74392421-74392443 TTTGAAAAGAATAATAATGAGGG - Intergenic
992948691 5:81834854-81834876 GATGAGAATGATGATGATGATGG - Intergenic
993152912 5:84183601-84183623 TATGAGAAAAATTAGGTTTAAGG + Intronic
993625433 5:90219147-90219169 GATGAAAAGACTTATGAAGATGG + Intergenic
993783314 5:92097233-92097255 GATGTGTAAAATTATGATGATGG + Intergenic
994165275 5:96601770-96601792 GATGAAAAGAATTATGATAAGGG - Intronic
994303186 5:98171385-98171407 GATGAGAAGAGTTAAGAGGAGGG + Intergenic
994459410 5:100053438-100053460 GATGAGAAAAATGATTATGAGGG + Intergenic
995997149 5:118314819-118314841 TATGAGATGTTTTTTGATGATGG + Intergenic
996155193 5:120090570-120090592 TATGATAAAAATGATGAAGAGGG + Intergenic
997109875 5:131063298-131063320 GATGAAAAGAGTTATGAAGATGG + Intergenic
997417956 5:133743517-133743539 TACGAAAAGATTGATGATGATGG + Intergenic
997775206 5:136597888-136597910 GATGATGAGAATGATGATGATGG - Intergenic
998429590 5:142059563-142059585 TATGACAAAAATTATGATGGTGG + Intergenic
999934384 5:156469837-156469859 TATGAGAAGAAATGCTATGAGGG + Intronic
999958303 5:156726202-156726224 TATTACAATAATTATGAGGAGGG + Intronic
1000172952 5:158721869-158721891 TCTGAGAAGAGTTATGACAATGG + Intronic
1000387799 5:160691712-160691734 TATGAGAAGAATTATGATGAGGG - Intronic
1004185391 6:13416991-13417013 TATGATAAGAATGATGATGATGG - Intronic
1004519588 6:16349075-16349097 CATAAGAAGAATTTAGATGAGGG + Intronic
1004569100 6:16827655-16827677 TATGATAAAAAATATGATAAGGG - Intergenic
1005405503 6:25483538-25483560 GATGATGATAATTATGATGATGG - Intronic
1005877312 6:30021063-30021085 TATCAGAAGAATTATTTTGTGGG + Intergenic
1007650804 6:43419838-43419860 AATGAGAAGAATAATGATTTTGG + Intergenic
1008395316 6:50999680-50999702 TATAACAATAATGATGATGATGG - Intergenic
1009228378 6:61037543-61037565 TATTAGAAGCAATATCATGAAGG + Intergenic
1010537950 6:77054037-77054059 TCAGAGAAGAATTGTTATGAAGG + Intergenic
1011795121 6:90944658-90944680 TATGAGAAAAATTATAGTGTTGG - Intergenic
1012148254 6:95713534-95713556 AATGAGAAGAGTTATGAGGATGG + Intergenic
1012233042 6:96782823-96782845 TAAGAGATGAATTAAGAAGATGG + Intergenic
1012317835 6:97801743-97801765 TTGGAGAATAATTATGAAGAGGG - Intergenic
1013904828 6:115203080-115203102 TAGGAGAACAATGATGATGCAGG + Intergenic
1014015562 6:116526316-116526338 TAGGAGAAGAATTTGGATGGAGG + Intronic
1019138112 6:169924646-169924668 TGTGATGAGAATGATGATGATGG - Intergenic
1020161299 7:5774055-5774077 GAAGAAAAGAATTCTGATGATGG + Intronic
1020920693 7:14260307-14260329 TATAAGCAGCATTATGATTATGG + Intronic
1021264258 7:18499665-18499687 TATTGGAACAATTATTATGAAGG + Intronic
1021361593 7:19719829-19719851 TATTTGAATAATTGTGATGATGG + Exonic
1022252645 7:28623954-28623976 TATGATAAGAACAATGATGATGG + Intronic
1023734201 7:43220506-43220528 TAAGAGATGACTTAGGATGAGGG - Intronic
1025961444 7:66225783-66225805 TTTGAGAAGAATTAGTATGAAGG + Intronic
1027609634 7:80344208-80344230 TATAATAATAATGATGATGATGG - Intergenic
1030505695 7:110419055-110419077 TTTAAGAAGATTTAAGATGAGGG - Intergenic
1031523138 7:122790860-122790882 TATAGGAAAAATTATAATGATGG - Intronic
1031644319 7:124204586-124204608 TAAGAGGCGAATTATGATCATGG - Intergenic
1031646179 7:124228992-124229014 TATAATAAGAGTAATGATGATGG - Intergenic
1033614069 7:142994478-142994500 TATGAGAAATTTTATCATGAAGG - Intergenic
1033619866 7:143052462-143052484 TATGACCATAACTATGATGATGG - Exonic
1033957810 7:146873636-146873658 TATGAGAAGAATAATAAGCATGG + Intronic
1037177585 8:15965257-15965279 GATGAGGACAATTATGAGGATGG - Intergenic
1038115264 8:24546700-24546722 TAGGAGAAAAATAATAATGAGGG + Intergenic
1039136815 8:34334184-34334206 TATGAGAAGAATATCGAGGAAGG - Intergenic
1039237213 8:35514914-35514936 GATGAGAAGGATTATGTTGCCGG + Intronic
1040116481 8:43626520-43626542 TATTATCACAATTATGATGATGG - Intergenic
1042660665 8:71150708-71150730 GATGATAATAATGATGATGATGG - Intergenic
1043133127 8:76487282-76487304 TAGGAGTAGGATTAAGATGATGG - Intergenic
1044630430 8:94273029-94273051 TAGGGTAATAATTATGATGATGG - Intergenic
1044673504 8:94707493-94707515 TATTAGAAGAATTGTACTGATGG + Intergenic
1045276645 8:100712423-100712445 TATGTGAAAAATCTTGATGATGG - Exonic
1045364793 8:101466038-101466060 GATGAGAAGCGTTATAATGATGG + Intergenic
1046698602 8:117373800-117373822 GATAAGAAGAATTACTATGAAGG + Intergenic
1046920329 8:119721135-119721157 AATGAGAAAAATTAGGATAAGGG - Intergenic
1047481002 8:125282904-125282926 TATGAGAATCGTTCTGATGAGGG + Intronic
1047489734 8:125364679-125364701 TCTTGGAAGAATGATGATGAGGG + Intronic
1050340800 9:4636624-4636646 TATGAGAAGAATTCTGATGAGGG + Intronic
1050802737 9:9636530-9636552 TATAAGAAGAAATCTGATGAGGG + Intronic
1050971964 9:11889088-11889110 TTTGTAAAGAATGATGATGATGG + Intergenic
1051027347 9:12629024-12629046 TGTGAAAAGAATTTTAATGATGG - Intergenic
1051056793 9:12996935-12996957 TATGAGAAAAAGTATGAAGTAGG + Intergenic
1051197104 9:14574194-14574216 TCTGAGAAGAATTTTTATCATGG - Intergenic
1051395651 9:16617397-16617419 TATGAAAAGAATTATGAAAATGG + Intronic
1053945439 9:43304500-43304522 GATGAAAAGAATTATGGAGATGG - Intergenic
1054724106 9:68633291-68633313 TACAAGAAGAATTATGATACAGG + Intergenic
1054726996 9:68662731-68662753 TAAGAGGAGATTTTTGATGAAGG - Intergenic
1054871848 9:70054371-70054393 TATGAGAAGAATTAGGAAAGTGG + Intronic
1055163920 9:73167372-73167394 GAGGTGAAGAATGATGATGAGGG + Intronic
1055287267 9:74741965-74741987 TGTGAGAAGAATCAAGATCAAGG + Intronic
1055370656 9:75594683-75594705 TTTGAGAAGAATTTTTATAATGG + Intergenic
1056030084 9:82544569-82544591 TATGAGAAGGAATATGTTTATGG + Intergenic
1057378870 9:94550919-94550941 TATGGTAAGAAATATTATGAAGG - Intergenic
1057456260 9:95214886-95214908 TATGAAAAGAGTTCTGAGGATGG + Intronic
1058006142 9:99917137-99917159 TATCAGAATAATTATAATGTAGG + Intronic
1059411290 9:114133906-114133928 GATGATAAGAATGGTGATGAAGG + Intergenic
1059708334 9:116844265-116844287 TAGGAGAAGAATAATGAACATGG - Intronic
1060036018 9:120256445-120256467 GATGTGATGAAATATGATGAGGG + Intergenic
1060577876 9:124714280-124714302 TATGAGAAGAGTTATGTGGATGG + Intronic
1203588574 Un_KI270747v1:33078-33100 GATGAAAAGAATTATGGAGATGG - Intergenic
1185967679 X:4625937-4625959 TATGAGAAGAACAATAATCAGGG + Intergenic
1188331519 X:28877520-28877542 TATTAGAATAACTATGATAATGG - Intronic
1188375558 X:29424058-29424080 TATGAGATGAATGATCATAAAGG + Intronic
1188458915 X:30399569-30399591 TATGCTTAGAATTATGTTGATGG - Intergenic
1188737532 X:33737163-33737185 TATCAGCAGAGTGATGATGATGG - Intergenic
1189100517 X:38184366-38184388 TATGTCTAGAATAATGATGAAGG - Intronic
1189426376 X:40905158-40905180 GATGAAAAGAATTATGGAGATGG + Intergenic
1191692170 X:63951870-63951892 TATGAGTAGATTTATCATAAGGG - Intergenic
1193583750 X:83295115-83295137 TAAGGGAAGAATCATGAAGAAGG + Intergenic
1193690768 X:84639458-84639480 TCTGTGAAGAATGATGATGATGG - Intergenic
1194083296 X:89495039-89495061 TATGAGAAGACTTTTTATTATGG + Intergenic
1194314158 X:92353478-92353500 TAGGAGTAGAATTAAGTTGATGG - Intronic
1194323835 X:92485287-92485309 AATGATAAGAATAATGATGTAGG + Intronic
1194621464 X:96178035-96178057 TTTGAGAATAATAATGATAAAGG + Intergenic
1194713425 X:97262872-97262894 GATGAGAAGAATTTTAACGAAGG + Intronic
1195694350 X:107655671-107655693 TGTGATAAGTACTATGATGAGGG + Intergenic
1196371631 X:114985647-114985669 AAAGAGAAGAATAATGATGCTGG - Intergenic
1197140433 X:123111826-123111848 GAAGAGAAGAATAATGATGAGGG - Intergenic
1197153259 X:123243278-123243300 TATTAGAATAATTTTGATCATGG - Intronic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197302071 X:124793381-124793403 CTGGAGAATAATTATGATGATGG - Intronic
1200305667 X:155023800-155023822 TATGAGAAGAAACTTGATCAGGG + Intronic
1200622279 Y:5465320-5465342 TAGGAGTAGAATTAAGTTGATGG - Intronic
1201964996 Y:19722928-19722950 TCTGTGAAGAATGATGTTGATGG - Intronic