ID: 1000388731

View in Genome Browser
Species Human (GRCh38)
Location 5:160701038-160701060
Sequence CCATTGCCACACACCCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000388726_1000388731 17 Left 1000388726 5:160700998-160701020 CCATTACATGTGTGTCTGTTTGC 0: 1
1: 0
2: 2
3: 18
4: 352
Right 1000388731 5:160701038-160701060 CCATTGCCACACACCCATCCAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000388731 Original CRISPR CCATTGCCACACACCCATCC AGG Intronic
900329773 1:2128231-2128253 CCACTGCCTTGCACCCATCCGGG + Intronic
901927051 1:12572990-12573012 CCTCTACCCCACACCCATCCAGG + Intronic
903025539 1:20427565-20427587 TCACTGCCACACCCCCAACCTGG + Intergenic
903329360 1:22589252-22589274 CCCCTGCCTCAGACCCATCCAGG + Intronic
904121027 1:28197876-28197898 CCATAGCCACAGCCCCACCCTGG + Intergenic
904200233 1:28814729-28814751 GCATTCCCACACAGCCTTCCCGG + Intronic
904700524 1:32355268-32355290 CCATTTCCAAACTCCCAGCCAGG + Intronic
905141746 1:35851477-35851499 CCACTCCCACACACACATCCAGG - Intronic
905281080 1:36849825-36849847 CCACTGCCACACCCCCTGCCTGG - Intronic
905891741 1:41522322-41522344 CCATTGCCACCATCCCAACCTGG + Intronic
906130072 1:43450675-43450697 CCACAGCCACTGACCCATCCAGG + Exonic
906142583 1:43542533-43542555 CCATGGCCAGACTCTCATCCAGG + Intronic
906490110 1:46261660-46261682 ACATTGCCACCCACCCTTCAAGG - Intronic
906686449 1:47766255-47766277 CCAGAGCCACACAACCAGCCTGG + Intronic
907527737 1:55063595-55063617 CCCTCCCCAGACACCCATCCTGG - Exonic
909929313 1:81477090-81477112 CCATTGCCACTAACCCACCCTGG + Intronic
910216172 1:84847355-84847377 CCACTCCCACACACACATGCTGG - Intronic
914713518 1:150235643-150235665 CCATCCCCGCACACCCACCCAGG + Intronic
916463627 1:165050408-165050430 CCCTTGCCACATACTCCTCCTGG - Intergenic
920266744 1:204729751-204729773 CCATGCCCACACAGCCACCCAGG + Intergenic
920357687 1:205386750-205386772 CCCTTACCACATACCCTTCCAGG + Intronic
920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG + Intergenic
920986769 1:210897943-210897965 CCACTGCCACTTACCCCTCCAGG - Intronic
1065456963 10:25916962-25916984 GCTTGGCCACACACACATCCTGG + Intergenic
1070238601 10:74655763-74655785 CCCTGGCCACCCACCTATCCAGG + Intronic
1070688331 10:78506651-78506673 CCATGGCCACTCACCTAACCAGG + Intergenic
1072054608 10:91741616-91741638 CCAATGTTACAAACCCATCCTGG - Intergenic
1072988184 10:100162390-100162412 CCATTTCCACACATCCTTCTTGG - Intronic
1074960704 10:118442732-118442754 CTACTGCCACACACCATTCCAGG - Intergenic
1075092210 10:119450206-119450228 CCTTTGCCACACCCCCAGTCTGG - Intronic
1075734866 10:124658386-124658408 CCATTGCCACATCCCTACCCTGG + Intronic
1076117611 10:127911396-127911418 GCAGTGCCTCACACCCAGCCTGG - Intronic
1076527547 10:131121794-131121816 ACAGTGCCACACACCCATGCTGG + Intronic
1079293902 11:19214432-19214454 CCATTACAACACCGCCATCCAGG - Intergenic
1080739632 11:35051539-35051561 CCATGGCCTCACACCCAACAGGG - Intergenic
1081850425 11:46271828-46271850 CCACTGCCACCCACCCTTCTGGG + Intergenic
1082033518 11:47625011-47625033 CCATTGCAACAGACACCTCCTGG - Intronic
1083678907 11:64342432-64342454 CCATTGCCTCCCTCCCAACCCGG + Intronic
1084602113 11:70151980-70152002 CCAGGGTCACCCACCCATCCCGG + Intronic
1085296526 11:75434699-75434721 ACTTAGCCACACACCCACCCTGG + Exonic
1087264450 11:96045075-96045097 CCATCTCCACCCACCCACCCTGG - Intronic
1088764795 11:112963689-112963711 CCATTGTCACGCTCCCACCCGGG - Intronic
1092390817 12:8077058-8077080 CCATTGCCCCACATCCTTACCGG + Intergenic
1096231285 12:49898222-49898244 CCATTATCAAACACCCAGCCCGG + Intronic
1096493862 12:52027787-52027809 GCAGAGCCACACACCCCTCCAGG + Intronic
1096742382 12:53703237-53703259 CCATTTCCACACCCTCCTCCTGG + Intergenic
1097442411 12:59626617-59626639 CATTTGCCAGCCACCCATCCTGG + Intronic
1098645382 12:72894251-72894273 GCATTGCCTAACACCTATCCAGG + Intergenic
1100956586 12:99915636-99915658 CCATTGCCACAGACCCCTGCAGG - Intronic
1101943201 12:109116083-109116105 CCATTGCCACATTCTCATTCAGG - Intergenic
1101982552 12:109420302-109420324 ACATTGCCACATATCCCTCCGGG - Intronic
1104963375 12:132498519-132498541 CCATCCCCACACACCTGTCCTGG + Intronic
1106659550 13:31784405-31784427 TCATGGCAACAAACCCATCCAGG + Intronic
1108360327 13:49663094-49663116 ACAATGCCAGAGACCCATCCAGG + Exonic
1112102887 13:96209660-96209682 CTCATGCCACCCACCCATCCAGG + Intronic
1118611692 14:67546463-67546485 CCATTGCAACCTCCCCATCCTGG + Intronic
1118935382 14:70283311-70283333 CCATTGCCACTCAGGCATCACGG - Intergenic
1121786087 14:96662191-96662213 TCAAGGCCACACACTCATCCTGG - Intergenic
1122691195 14:103532878-103532900 CCCTTGCCCCACCCCCACCCAGG - Intronic
1122864856 14:104599079-104599101 GAATGGCCCCACACCCATCCTGG - Intronic
1124367008 15:29079266-29079288 CCATTGCAGCTGACCCATCCAGG + Intronic
1125745419 15:41994301-41994323 CCTGTGCCACACACCCCCCCGGG - Intronic
1127668375 15:61171228-61171250 CCACAGCCCTACACCCATCCAGG + Intronic
1129061667 15:72865326-72865348 CCATTACCACATACTCTTCCAGG + Intergenic
1129290499 15:74563262-74563284 CCAGGTCCACACCCCCATCCTGG - Intronic
1131373649 15:91905567-91905589 CCATTTCCACAGGTCCATCCAGG - Intronic
1132824462 16:1896486-1896508 CCACCGCCACGCACCCAGCCTGG - Intergenic
1132824474 16:1896526-1896548 CCACCGCCACGCACCCAGCCTGG - Intergenic
1133220571 16:4317560-4317582 CCCAGCCCACACACCCATCCCGG + Intronic
1134913472 16:18050061-18050083 CCAATGCCACACCCCCTTCACGG - Intergenic
1136601857 16:31297646-31297668 CCATTGCCACTCACCCCCCTGGG - Exonic
1137497506 16:48981989-48982011 CCAATCCCACACACCCATTCTGG + Intergenic
1137673582 16:50292920-50292942 GCATGGCCAGACACCCATGCAGG + Intronic
1137737214 16:50733812-50733834 CCATAGACACACTCCCATGCAGG - Intergenic
1140900682 16:79364433-79364455 ACACTGCCACCCACCCAGCCTGG - Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1144713656 17:17419775-17419797 CCATTGGAATACACCCAGCCAGG + Intergenic
1145964165 17:28905084-28905106 CCATTGTCATCCACCCACCCTGG + Intergenic
1146139707 17:30355056-30355078 ACATTGCCATAAACCCATCCAGG + Intergenic
1149553575 17:57557559-57557581 CCCTGGCCACACACCCTTCAAGG - Intronic
1150474586 17:65465273-65465295 GCAGAGCCCCACACCCATCCTGG + Intergenic
1150756799 17:67921954-67921976 TCACTGCAACACCCCCATCCTGG - Intronic
1151260081 17:72909255-72909277 CCATTGCATCCCACCCATTCTGG + Intronic
1151419090 17:73985667-73985689 CCCTTGCCTCTCACCCAGCCAGG + Intergenic
1151979413 17:77499742-77499764 CCCCTGCCACTCACCCTTCCTGG + Exonic
1152292697 17:79449177-79449199 ACAGTGCCAGAAACCCATCCCGG - Intronic
1152585576 17:81188096-81188118 CCAGTGCCACACACGGCTCCAGG + Intergenic
1152589045 17:81202305-81202327 CCAGTGCCACCCACTCAGCCCGG - Exonic
1153227711 18:2910635-2910657 CCACTGCCCCACCCCCCTCCAGG - Intronic
1154148381 18:11885507-11885529 CCCTTGCCAAACACCCTTCCGGG - Exonic
1160163514 18:76492144-76492166 CCATTGCATCATCCCCATCCCGG + Intronic
1160525574 18:79533577-79533599 CCTTCGCCACAGTCCCATCCTGG - Intergenic
1160734640 19:656952-656974 CCATTCCCAGAGACCCACCCAGG - Intronic
1161989928 19:7678813-7678835 CCCCTGCCCCACACCCACCCTGG - Intronic
1163136946 19:15318810-15318832 CCTTTGCAACAGACCCATTCTGG + Intronic
1167793499 19:51694551-51694573 CCATCCCCACACACTCACCCTGG - Intergenic
925701718 2:6645632-6645654 TCAGATCCACACACCCATCCTGG - Intergenic
932105103 2:68935144-68935166 CCATTGGCACACTCATATCCTGG + Intergenic
932405851 2:71512232-71512254 CCATCCCCACACACCCTTCTTGG - Intronic
935373480 2:102371572-102371594 CCAAAGCCACCCTCCCATCCTGG + Intronic
935632370 2:105222705-105222727 CCATAGCCACCCTGCCATCCTGG + Intergenic
936625224 2:114141407-114141429 CCTTTCCCACTCACCCCTCCAGG - Intergenic
938107898 2:128545645-128545667 CCAATCCCAGACACCCACCCTGG - Intergenic
938843092 2:135181748-135181770 CCATGGCCACACCTCCAGCCTGG - Intronic
945899417 2:215521099-215521121 CCACTACCACACAGCTATCCTGG - Intergenic
946113455 2:217440393-217440415 CCATTGCCATAAACTCATACTGG + Intronic
948702732 2:239770347-239770369 CCCTGCCCCCACACCCATCCAGG + Intronic
949058707 2:241944063-241944085 CCAGTGCCAAACACACACCCTGG - Intergenic
1175473820 20:59254491-59254513 TCATTTCCCCACACCCATACTGG - Exonic
1175531663 20:59677338-59677360 CCACTCCCACACTCCCACCCAGG - Intronic
1176072137 20:63232807-63232829 CCAAAGCCACCCAGCCATCCGGG - Intergenic
1181493905 22:23277328-23277350 CCATGGCCTCACTCGCATCCTGG - Intronic
1183676534 22:39301909-39301931 CCACGCCCACCCACCCATCCAGG + Intergenic
1184345480 22:43910190-43910212 CCATTGTCCCACCCCCTTCCTGG + Intergenic
1184992871 22:48182466-48182488 GCATGGGCACACACGCATCCTGG - Intergenic
1185219733 22:49623339-49623361 CCATAGCCACTGCCCCATCCAGG - Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
949617068 3:5765557-5765579 CCATAGCCAAGCATCCATCCAGG - Intergenic
950187648 3:10955196-10955218 CCACTGTCACCCACCCCTCCTGG - Intergenic
950572309 3:13809057-13809079 CCAGGGCCACACATCCATCAGGG - Intergenic
951036690 3:17940197-17940219 CGATTGCCACAGCCCCAACCAGG - Intronic
951161895 3:19433251-19433273 CCATTGCTATACAACCTTCCAGG - Intronic
954301566 3:49703300-49703322 CTTTGGCCACTCACCCATCCAGG - Intronic
954624090 3:52012992-52013014 CCCTTCCCCCACACCCAACCTGG - Intergenic
957128239 3:76190291-76190313 CTATTGCCACACACCTCTTCGGG - Intronic
960950266 3:122994495-122994517 CCATCAGCACACACCCATCATGG - Intronic
962915759 3:139902091-139902113 CCATTTGCACATCCCCATCCTGG + Intergenic
968497578 4:927126-927148 GCACTGCCCCACACCCCTCCCGG + Intronic
968497613 4:927237-927259 GCACTGCCCCACACCCCTCCCGG + Intronic
969352596 4:6606361-6606383 CCCTTGCCAGCCACCCATGCTGG - Intronic
969415221 4:7053465-7053487 TCCTGGCCGCACACCCATCCTGG - Intronic
970585789 4:17512632-17512654 CCATCGCCAGACACAGATCCTGG + Intergenic
971532798 4:27710263-27710285 CCACTGCCACACACACACACAGG - Intergenic
981237389 4:142435039-142435061 CCATTGAGACACAGCAATCCTGG - Intronic
982834944 4:160111758-160111780 CCATTTCCACATACCCATAAAGG - Intergenic
983197321 4:164821868-164821890 CCATTCTCTCACCCCCATCCAGG - Intergenic
984289794 4:177781270-177781292 CCCTTGTCACACACCCTTCGAGG - Intronic
985579105 5:687411-687433 CCCTGGCCTAACACCCATCCTGG - Intronic
985593947 5:779474-779496 CCCTGGCCTAACACCCATCCTGG - Intergenic
988499965 5:31776302-31776324 CCATTGCCACTCCCCTATCCAGG + Intronic
990722570 5:58713270-58713292 CCATGGCCACACAGCAATGCAGG + Intronic
997890130 5:137668691-137668713 TCATTGCCACACACAACTCCAGG + Intronic
998227157 5:140335936-140335958 CTATGACCACACAACCATCCTGG - Exonic
998382357 5:141734934-141734956 CCCTGCCCACACACCCATCCTGG - Intergenic
998473972 5:142405563-142405585 ACATTTCAACACGCCCATCCAGG - Intergenic
998775352 5:145594257-145594279 CTATTTCCCCACACCCATACTGG + Intronic
1000388731 5:160701038-160701060 CCATTGCCACACACCCATCCAGG + Intronic
1001717564 5:173829043-173829065 CCATTGCACCACAGGCATCCAGG + Intergenic
1002169912 5:177369214-177369236 CCATCCCCACAGACCCATCCTGG + Intronic
1002715744 5:181225851-181225873 CCACTGCTTCAAACCCATCCAGG - Intronic
1006946354 6:37787045-37787067 CCACTGCCACCCACTCCTCCTGG + Intergenic
1008506944 6:52240079-52240101 CCATTGCCACTGACCCTTACTGG + Intronic
1015230714 6:130912154-130912176 CCATTCCCTCACCCCCACCCCGG + Intronic
1015909822 6:138159536-138159558 CCTATGCCACATACACATCCAGG + Intergenic
1017393268 6:153965560-153965582 CCATTGCAACATACGCCTCCTGG + Intergenic
1017756800 6:157536179-157536201 TTATTGCCACACTCCAATCCAGG - Intronic
1017865740 6:158441767-158441789 CCCTTCCCACACACACACCCTGG + Intronic
1017954438 6:159167307-159167329 CCAGAGCCACAGGCCCATCCTGG + Intergenic
1019276098 7:176818-176840 CCACAGCCTCACACCCGTCCTGG - Intergenic
1019304686 7:327632-327654 CCGTTGCCACAAGCCCACCCTGG - Intergenic
1026639096 7:72108873-72108895 CCATTGCAAAACACCAAACCAGG + Intronic
1032307600 7:130751143-130751165 CTGTTGCCTCACACCCTTCCTGG - Intergenic
1033035514 7:137872622-137872644 ACATTGCCCCACACCCAAGCTGG - Intergenic
1034620871 7:152456180-152456202 CCACTGCCACAGAAACATCCCGG + Intergenic
1037305741 8:17501752-17501774 CAATACCCACACACCCATTCTGG + Intronic
1039158717 8:34592945-34592967 CCATTGCCACTCCCCCACCCCGG - Intergenic
1040826560 8:51627742-51627764 CCCTTGCCCCACCCCCATCCTGG + Intronic
1045319382 8:101070193-101070215 CCACTCCCACACACCCATCCAGG - Intergenic
1047495679 8:125407022-125407044 CCACTTCCACCCACCCATCCAGG - Intergenic
1049462589 8:142737016-142737038 CCCATGCCAGACACCCATCTTGG - Intergenic
1050256044 9:3793287-3793309 GCATTGCCAAACACCCACCTTGG + Intergenic
1053474234 9:38370484-38370506 CACCTGCCACACTCCCATCCTGG + Intergenic
1057102645 9:92377493-92377515 CCCTTGCCACACTCCCTACCTGG - Intronic
1057822136 9:98340813-98340835 CCAATGCCACACATCCATGTTGG - Intronic
1058745858 9:107989998-107990020 CCATTTGCAGAAACCCATCCTGG + Intergenic
1061006508 9:127931065-127931087 CCTGTGCCACCCACCCATTCCGG + Intergenic
1061941671 9:133887252-133887274 CCCTTCCCCCACCCCCATCCTGG - Intronic
1062049809 9:134441482-134441504 CCATGCACACACACCCATACAGG + Intergenic
1187228429 X:17397214-17397236 GCATGGCCACACAACCAACCGGG + Intronic
1190598448 X:52067869-52067891 CCTTTCCCACACAACCCTCCTGG + Intronic
1190610376 X:52186204-52186226 CCTTTCCCACACAACCCTCCTGG - Intronic
1192655372 X:72987912-72987934 CCTCTGCCAAACACCAATCCTGG + Intergenic
1193779295 X:85683252-85683274 CCAGAGCCACCCACCCTTCCTGG - Intergenic
1195900819 X:109795432-109795454 CCAGTCCCAGACACTCATCCTGG - Intergenic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic
1200368467 X:155694512-155694534 CCATTGTCCCTCACCCACCCCGG - Intergenic
1201513263 Y:14788814-14788836 TGTTTACCACACACCCATCCGGG + Intronic