ID: 1000393489

View in Genome Browser
Species Human (GRCh38)
Location 5:160749085-160749107
Sequence CTGGAGTCGCAGAAAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000393489_1000393493 25 Left 1000393489 5:160749085-160749107 CCATGTTCTTTCTGCGACTCCAG 0: 1
1: 1
2: 1
3: 15
4: 241
Right 1000393493 5:160749133-160749155 AGAACATAAAGTACTATATTTGG 0: 1
1: 0
2: 2
3: 40
4: 332
1000393489_1000393494 26 Left 1000393489 5:160749085-160749107 CCATGTTCTTTCTGCGACTCCAG 0: 1
1: 1
2: 1
3: 15
4: 241
Right 1000393494 5:160749134-160749156 GAACATAAAGTACTATATTTGGG 0: 1
1: 0
2: 2
3: 27
4: 352
1000393489_1000393491 0 Left 1000393489 5:160749085-160749107 CCATGTTCTTTCTGCGACTCCAG 0: 1
1: 1
2: 1
3: 15
4: 241
Right 1000393491 5:160749108-160749130 AAGTGAGTTATTAGTATTACCGG 0: 1
1: 1
2: 0
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000393489 Original CRISPR CTGGAGTCGCAGAAAGAACA TGG (reversed) Intronic
900148534 1:1168446-1168468 CTGGGGGCGCAGGAAGGACAAGG + Intergenic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901841864 1:11958577-11958599 CAGGAGCCGCTGGAAGAACAGGG - Exonic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
904241445 1:29148841-29148863 CAGGAGCCGCAGCAAGAGCAAGG - Exonic
904821921 1:33251103-33251125 CTGAAGGGACAGAAAGAACAGGG + Intergenic
906850752 1:49247583-49247605 CTGGAATCTCAGAAAAAAAAGGG - Intronic
907697367 1:56745808-56745830 ATGGGGTCACAGAAATAACAAGG - Intronic
907898704 1:58717764-58717786 GTGGATTCTCAGAAAGAAAAAGG + Intergenic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
910475251 1:87598904-87598926 CTGGTGTCTCAGAATGAACTTGG - Intergenic
912667742 1:111598143-111598165 ATGGTATAGCAGAAAGAACAGGG - Intronic
913006030 1:114632198-114632220 CTGGAGTCGCAGAAATGAAGGGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
920388586 1:205584850-205584872 CAGGAGGCACAGGAAGAACAGGG - Intronic
922257071 1:223901645-223901667 GTAGAGCCACAGAAAGAACATGG + Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
924338264 1:243004456-243004478 GTAGAGCCACAGAAAGAACATGG + Intergenic
924496265 1:244593077-244593099 CTGGAATAGCACAACGAACATGG + Intronic
924623620 1:245683258-245683280 CTGGAATCGCAGACACAGCATGG + Intronic
1062989779 10:1804570-1804592 CTGTAGCCACAGAAACAACAGGG + Intergenic
1064087423 10:12355837-12355859 CTGGAGCCACAGAAAATACAAGG + Intronic
1067581936 10:47451679-47451701 CTGGAATCGCAGCTAAAACAGGG + Intergenic
1067826793 10:49580218-49580240 CTGGAGTCTCTGAAAGGGCAGGG + Intergenic
1069797346 10:71061867-71061889 CCGGAGCTGCAGAAAGAGCAGGG - Intergenic
1070588775 10:77786815-77786837 CTGAAGCTCCAGAAAGAACAGGG + Intergenic
1071431798 10:85612416-85612438 CTGGAGGCTCAGATAGTACAGGG - Intronic
1072241843 10:93503815-93503837 CTAGCGTCATAGAAAGAACAAGG + Intronic
1073080252 10:100855155-100855177 CTCCAGTTGCACAAAGAACATGG + Intergenic
1073515409 10:104071388-104071410 AAGGAGTAGAAGAAAGAACATGG - Intronic
1073851148 10:107619675-107619697 CTTGGCTCGCAGAAAGAACATGG - Intergenic
1073899267 10:108201037-108201059 ATGGCATAGCAGAAAGAACATGG - Intergenic
1074368658 10:112880741-112880763 GAGGAATAGCAGAAAGAACATGG + Intergenic
1075586170 10:123659669-123659691 CTGGAGTGGGACAAAGAACTAGG + Intergenic
1075669728 10:124256182-124256204 ATGGAGTCACAGAAATAACTCGG + Intergenic
1076065461 10:127444494-127444516 CTGGAGGGGCAGAAAGTGCAGGG + Intronic
1076133261 10:128028277-128028299 CTGAGGTCGCAGAAAGGACTGGG - Intronic
1076349441 10:129805802-129805824 CTGGAATGGGAGAAAGAATATGG - Intergenic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1079100112 11:17535908-17535930 GTGGCGTAGCAGAAAGAACATGG - Intronic
1079152078 11:17909015-17909037 CTGGAATCACAGAAAAAACCTGG + Intronic
1079531753 11:21462669-21462691 CTGGAGCTGCAGGATGAACAAGG - Intronic
1080479269 11:32629204-32629226 CTGAAGTCCCAGAAAGTAGAGGG + Intronic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1084631352 11:70353353-70353375 CTGGAATCACAGCAAGAACCTGG + Intronic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1087009980 11:93504150-93504172 TTGGAGTTGCAGAAATATCATGG - Intronic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087750211 11:101998919-101998941 ATGGTGTGGCAGAAAGAACATGG - Exonic
1088685729 11:112283097-112283119 CTTGTGTAGCAGACAGAACATGG - Intergenic
1090431749 11:126652239-126652261 CTGGTTTCACACAAAGAACAAGG - Intronic
1091127877 11:133118204-133118226 AGAGAGTCCCAGAAAGAACAGGG - Intronic
1091159071 11:133402992-133403014 ATATAGTCACAGAAAGAACATGG - Intronic
1091829334 12:3538511-3538533 GTGGAGTCCCAGGAAGCACATGG + Intronic
1091903754 12:4165816-4165838 CTGGAGTCTCAGGAAAAGCAGGG - Intergenic
1092659408 12:10722729-10722751 CTGGAGACGCTGACAGCACAGGG - Intronic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1094081079 12:26536634-26536656 ATGGAGTAGCAGCAAGAACTGGG + Intronic
1095109301 12:38274470-38274492 CTGGAGGTGGAGAAGGAACAAGG + Intergenic
1098622957 12:72627066-72627088 ATGGAATAGCAAAAAGAACAGGG + Intronic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1100608644 12:96172114-96172136 CTTGAGTGGCAGAAGGAACCTGG - Intergenic
1102124321 12:110468294-110468316 CTGGAGGCGTAGAAAGAATGTGG - Intronic
1103280202 12:119751482-119751504 CTAGTCTCTCAGAAAGAACAAGG + Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1107830057 13:44367128-44367150 CTGAAGTGGCAGACAGGACATGG - Intergenic
1107947423 13:45431709-45431731 CTGGAGTAGCAAACAGAGCAGGG - Intergenic
1108543694 13:51469431-51469453 ATGGAGTCACTAAAAGAACATGG - Intergenic
1109129068 13:58557641-58557663 GTGGAGTAACAGAAAGAAAATGG - Intergenic
1109476882 13:62891014-62891036 CTGGAGTGGAAGGAGGAACATGG + Intergenic
1113220228 13:108092465-108092487 CCGCAGTGGCAGAAAGAGCAAGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114729976 14:24982222-24982244 CTGGAGTTGAAAAAAGAATATGG - Intronic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115775573 14:36711125-36711147 GTGGAGTCTTAGAAAGATCAAGG - Intronic
1118156605 14:63248683-63248705 GTGGAGCCACAGAATGAACAAGG + Intronic
1119439835 14:74620665-74620687 CTGGAGTAGTAGGAAGAACAAGG + Intergenic
1120442600 14:84559218-84559240 CTAGAGAGGGAGAAAGAACAGGG + Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127262590 15:57337113-57337135 CTGGAGGAGCAGCATGAACATGG + Intergenic
1127723486 15:61725566-61725588 CTGGGGTCGCAGAAAGAGAAGGG + Intergenic
1128256280 15:66199445-66199467 CTGGAGTCTCTGAAACATCAAGG - Intronic
1130757763 15:86783982-86784004 TTGGAGTAGAAGTAAGAACATGG + Intronic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133888432 16:9854265-9854287 CTGAAGTTGCAGTAAGAGCAAGG - Intronic
1134191247 16:12122646-12122668 CTGGAGCGGCAGAGAGGACATGG + Intronic
1135595024 16:23735206-23735228 CTGGTGTGGCAGAAAGATCTGGG + Intergenic
1137225225 16:46498525-46498547 CTGAAGTCTCAGAAAGAAATGGG + Intergenic
1137540587 16:49358972-49358994 GTGGAGCTGCAGAGAGAACATGG - Intergenic
1140959820 16:79900925-79900947 CTGCAATAGCTGAAAGAACATGG - Intergenic
1141046201 16:80718161-80718183 CTGGTATAGCAGAAAGAGCACGG - Intronic
1142257454 16:89021329-89021351 CTGAAGACGCAAAAAGAATAAGG + Intergenic
1142377707 16:89714995-89715017 TTGGAGTTCCAGAAAGAAAATGG - Intronic
1145221361 17:21092171-21092193 AGGGGGTCTCAGAAAGAACAGGG - Intergenic
1145304693 17:21667040-21667062 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1149442751 17:56688952-56688974 GTGAAGTTACAGAAAGAACAAGG + Intergenic
1149569395 17:57661773-57661795 ATGGAGTGGCAGAAAGAAAGGGG - Intronic
1149971483 17:61222732-61222754 CTGGAGTCGCAGAGTGGCCATGG - Intronic
1156040147 18:32811269-32811291 ATGGAATTGCAGAAAGAGCAGGG - Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1159036870 18:63285958-63285980 CTGCTGTTGCAGAAAGGACAGGG - Intronic
1159523503 18:69557630-69557652 CTGGAGTCCTAGCAACAACATGG + Intronic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1165038204 19:33049848-33049870 CTGGAGCAGCAGGAAGGACAGGG - Intronic
1167586733 19:50379640-50379662 CTGGTGTGGCTGAGAGAACAGGG + Intronic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
926434708 2:12826092-12826114 TTGGAGTAGCAGCATGAACAAGG - Intergenic
926639071 2:15215869-15215891 CTAGAGTAGTAGAAAGATCAGGG - Intronic
926790412 2:16565518-16565540 CTAGAGTACCAGGAAGAACAAGG - Intronic
928224839 2:29439831-29439853 CCAGAGTCTCAGAGAGAACATGG + Intronic
929560106 2:42951165-42951187 CTGGAGTTGGAGAAGGCACAGGG + Intergenic
936058791 2:109281186-109281208 CTGGGGTCGCAGGAGGGACAGGG - Intronic
936462098 2:112721690-112721712 CTGCAGCTGCAGAAAGCACAGGG - Intronic
938966680 2:136394778-136394800 CTGGAGGAACAGAAAGTACAGGG + Intergenic
940133704 2:150412578-150412600 CTGGAGTAGTTGAAAGGACATGG - Intergenic
940982949 2:160023842-160023864 AGGGAGTAGCAGAAACAACACGG + Intronic
942385652 2:175439770-175439792 AGGGAGTGACAGAAAGAACATGG + Intergenic
942551304 2:177122406-177122428 CTGGAGTCTGAGGAAGAAAATGG - Intergenic
943809319 2:192164342-192164364 CTTAAGTAGTAGAAAGAACAAGG - Intronic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
944577886 2:201107160-201107182 GTGGCGTAGCAGAAAGAACATGG - Intergenic
945201421 2:207285484-207285506 CTTGAGTCCCAGCAAGAGCAGGG - Intergenic
946060157 2:216934500-216934522 AGGGAGTGGCAGAGAGAACATGG - Intergenic
947550375 2:231041357-231041379 CTGGAGCCGGAGGAAGAACCAGG + Exonic
947941384 2:234059021-234059043 CTGGAGTCACACAAAGAACTTGG + Intronic
1169852307 20:10065470-10065492 CTGGAAAGGCAGAAAGAAAAGGG + Intergenic
1170142381 20:13137899-13137921 CTTGAGTAGCAGAAAGCTCAGGG - Intronic
1171522208 20:25784480-25784502 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171529957 20:25846425-25846447 CTGGAGGAGCAGAAAGAATGAGG - Intronic
1171554619 20:26071403-26071425 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1172648243 20:36484757-36484779 CTGGAGCCCTAGAAGGAACAAGG + Intronic
1174101074 20:48126596-48126618 CTGGAGACGCAGGGAGAAGATGG - Intergenic
1174149524 20:48476308-48476330 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149593 20:48476707-48476729 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1176656011 21:9589477-9589499 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1177075813 21:16571829-16571851 CTGTAGTTGCACAATGAACATGG + Intergenic
1178991914 21:37364004-37364026 TTGGTGTGGTAGAAAGAACATGG + Intergenic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1180634979 22:17257078-17257100 CTGGAGTGGTGGAAAGAACTGGG - Intergenic
1181872323 22:25909841-25909863 CTGGGGTGGCAGAAAGAGCTGGG + Intronic
1182804152 22:33056805-33056827 TTGGTGTAGTAGAAAGAACAAGG - Intronic
949631307 3:5929683-5929705 CAGGAATTGCAAAAAGAACAAGG - Intergenic
951857193 3:27210596-27210618 CAGAAGTCGCAGAAGGAATAGGG - Intronic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953350941 3:42215657-42215679 CAAGAGTGGCAAAAAGAACATGG + Intronic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
953679636 3:45029743-45029765 CTGGTGTTTCAGAAAGACCAGGG + Intronic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
954745058 3:52783013-52783035 CTCGAGTCCCAAAAAGAACCAGG - Exonic
955516888 3:59734848-59734870 CTGGAGTCTCAGGAAAAGCAAGG - Intergenic
955931976 3:64066495-64066517 GTAGAGTGGCAGAAAGAGCAGGG + Intergenic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
955980071 3:64515885-64515907 TTGGAGGGGCAGAAAGACCATGG + Exonic
956277634 3:67520329-67520351 CTGGATACCCAGAAAGAAAAAGG + Intronic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
960715242 3:120568780-120568802 ATGGTGTCGTGGAAAGAACAAGG - Intergenic
960962477 3:123082105-123082127 CTGGACTTGCAGAAAGCAGAGGG + Intronic
962735455 3:138321596-138321618 CTGGAGCAGCTGAAAGAGCATGG - Intronic
962875854 3:139535632-139535654 CTGGGGTCGCAGAGGCAACAAGG - Intronic
962920527 3:139946453-139946475 GTGGAGTAGCAGCAAGACCAAGG - Intronic
964966202 3:162496348-162496370 CTGGAGGCCTAGAAAGAAAATGG - Intergenic
966947304 3:184785838-184785860 CAGGGATCGCAGAAAGAAAAAGG + Intergenic
967125258 3:186417754-186417776 CTGGAGTAACAGTAACAACATGG - Intergenic
967962383 3:194936494-194936516 CTGGCTTCACAGAAAGTACAAGG - Intergenic
968956575 4:3722572-3722594 CTGGAGTTGCAGCAAGACCAGGG - Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
971198097 4:24488456-24488478 CTTGAATCACAGACAGAACAAGG + Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974713954 4:65641233-65641255 CTAGAGAGGCAGAAAGGACACGG + Intronic
979238855 4:118430823-118430845 GTAGAGCCACAGAAAGAACATGG - Intergenic
979472713 4:121120159-121120181 CTAGAGGCGCTGAAAGACCAAGG + Intergenic
981656428 4:147117069-147117091 CTGGTGTAGCAGAAGGATCATGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
982107617 4:152024463-152024485 CTGCAGGTGCAGAAAGCACAAGG - Intergenic
983870734 4:172822449-172822471 CTGGAGTTCCAGAGAGACCATGG - Intronic
986612960 5:9588433-9588455 CTGAAGGGGCAGAAAGAACTAGG - Intergenic
989126699 5:38060638-38060660 CTGGATTTGAAGAAAGAAAAGGG - Intergenic
989142474 5:38215247-38215269 CTGGAGAGGCAACAAGAACATGG - Intergenic
993042679 5:82833360-82833382 TTGAAGTTACAGAAAGAACAGGG + Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
994109653 5:95986945-95986967 TTGGAGTGGCAGAAAGGAGATGG + Intergenic
996390281 5:122952943-122952965 CTGGAGTCCCAGAAGGAAAGGGG + Intronic
998252997 5:140564966-140564988 CAGGAGCCGCAGAAGAAACAAGG - Exonic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1000807737 5:165817680-165817702 GTGGGGTCGCATAATGAACAAGG - Intergenic
1001621314 5:173087677-173087699 CTGGAGTCTCAAAAAGAAAAAGG + Intronic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1005714893 6:28537574-28537596 CTGGAGCCACAGAAATAATAAGG - Intergenic
1007291701 6:40792181-40792203 CTGGAGTCTCTGAAAGAAACTGG - Intergenic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1009509976 6:64538873-64538895 CTGGTGGAGTAGAAAGAACATGG - Intronic
1011161834 6:84399809-84399831 CAGGAGTCCCAGAAAGCCCAGGG - Intergenic
1011844183 6:91542396-91542418 GTAGAGTCCCAGAAAGAAAAAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1014111672 6:117624467-117624489 GTGGAGTCCTTGAAAGAACAGGG - Intergenic
1014281772 6:119449409-119449431 ATGGATTCACAGAAAGAACCTGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1016672799 6:146728401-146728423 CTGTAGTCTCAGAAAAAACAAGG - Intronic
1016792685 6:148082160-148082182 CTGGACTCACAGAAAAAGCACGG - Intergenic
1016887817 6:148974530-148974552 CTGCTTTCCCAGAAAGAACATGG - Intronic
1017644600 6:156527410-156527432 CTGGCCTGGCAGAAAGCACAGGG + Intergenic
1018703484 6:166446387-166446409 CTGTAGTCTCAGAAGGGACAAGG + Intronic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1020241196 7:6396419-6396441 CTGGGGACGAAGAAGGAACAAGG + Intronic
1020433046 7:8132821-8132843 ATGGAGTTCCAGAAAGAACTTGG - Intronic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022155929 7:27662294-27662316 CTGGGGGCGCTGAAAGACCAGGG + Intronic
1024194617 7:47047010-47047032 CTGGAGTCTCAAAAAGAGCCAGG + Intergenic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1025282698 7:57639655-57639677 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1025302019 7:57825762-57825784 CTGGAGGAGCAGAAAGAATGAGG + Intergenic
1026174105 7:67980800-67980822 CTGTGGTGGCAGAAAGGACAGGG - Intergenic
1026490043 7:70855466-70855488 CTAGAGTCACAGACAGAGCAGGG - Intergenic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1030864527 7:114683362-114683384 ATGGGGTAGCAGAAATAACAAGG + Intronic
1031147311 7:118010927-118010949 TTTGAGTTGCAGACAGAACAAGG - Intergenic
1031395287 7:121266299-121266321 CAGGAATGGCAGAAAGTACATGG + Exonic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1034587601 7:152109128-152109150 CTACAGCTGCAGAAAGAACAGGG - Intronic
1035102688 7:156414551-156414573 CTGGGGTGGGAGAAAGCACAGGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037744974 8:21635931-21635953 CTGAAGTCACTGAAAAAACAGGG + Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1043548789 8:81344998-81345020 CTGCAGCCTGAGAAAGAACAGGG + Intergenic
1044989598 8:97783786-97783808 CTGAAGTTACAGAAAGAATAGGG - Intronic
1045668034 8:104512334-104512356 CTGGAGTCGCAGTAAGCTAAAGG + Intronic
1047297618 8:123585243-123585265 CTGGAGTAGCAGATTTAACACGG + Intergenic
1048403301 8:134092801-134092823 CAGGAGTCCCAGAAAGGGCAGGG + Intergenic
1051799221 9:20912881-20912903 CTGGAGTTGCAGTTAAAACATGG + Exonic
1052295372 9:26891911-26891933 CTGGTGGCGTATAAAGAACATGG + Intronic
1056030884 9:82552177-82552199 CTGCAGTCACAGAAAGCACTTGG - Intergenic
1056105689 9:83344107-83344129 GTGGAGTAACAGAAAGGACAGGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058412342 9:104747738-104747760 GAGGAGTCTCAGAAAGGACACGG + Exonic
1059207371 9:112479487-112479509 CTCCAGTGGCAGAAAGAGCAAGG - Intronic
1061408091 9:130403617-130403639 CTGGGGTCACAGAATGACCAAGG - Intronic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1203633728 Un_KI270750v1:92937-92959 CTGGAGGAGCAGAAAGAATGAGG - Intergenic
1186714462 X:12235753-12235775 TTAGAGTCTCAGAAAGAACATGG + Intronic
1187604177 X:20865112-20865134 CAGGAGACGAGGAAAGAACATGG + Intergenic
1190337986 X:49274407-49274429 TTGGAGTAACAGAAAGACCATGG - Intronic
1190407865 X:50105465-50105487 CTGGTGTAGTAGAAAGAGCATGG + Intergenic
1192005585 X:67208528-67208550 CTTGAGAGGCAGACAGAACAGGG + Intergenic
1195564522 X:106325358-106325380 CTGGAATCACAAAAAGCACAGGG + Intergenic
1195935442 X:110121144-110121166 CTGAAGTCAAAGAGAGAACAAGG - Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1200143707 X:153914733-153914755 CTGGGGTCTGAGACAGAACAGGG + Intronic
1202386612 Y:24332631-24332653 GTAGAGCCACAGAAAGAACATGG - Intergenic
1202484173 Y:25337497-25337519 GTAGAGCCACAGAAAGAACATGG + Intergenic