ID: 1000395593

View in Genome Browser
Species Human (GRCh38)
Location 5:160771834-160771856
Sequence GGAGACAGTATGTGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000395593_1000395600 19 Left 1000395593 5:160771834-160771856 CCTGTTTCACACATACTGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1000395600 5:160771876-160771898 TATTCTAGGTACTGCTGGAAAGG 0: 1
1: 0
2: 1
3: 31
4: 202
1000395593_1000395603 26 Left 1000395593 5:160771834-160771856 CCTGTTTCACACATACTGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1000395603 5:160771883-160771905 GGTACTGCTGGAAAGGGGTATGG 0: 1
1: 0
2: 1
3: 15
4: 179
1000395593_1000395602 21 Left 1000395593 5:160771834-160771856 CCTGTTTCACACATACTGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1000395602 5:160771878-160771900 TTCTAGGTACTGCTGGAAAGGGG No data
1000395593_1000395597 5 Left 1000395593 5:160771834-160771856 CCTGTTTCACACATACTGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1000395597 5:160771862-160771884 GTTCGGTTCCATACTATTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 53
1000395593_1000395599 14 Left 1000395593 5:160771834-160771856 CCTGTTTCACACATACTGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1000395599 5:160771871-160771893 CATACTATTCTAGGTACTGCTGG No data
1000395593_1000395601 20 Left 1000395593 5:160771834-160771856 CCTGTTTCACACATACTGTCTCC 0: 1
1: 0
2: 0
3: 17
4: 194
Right 1000395601 5:160771877-160771899 ATTCTAGGTACTGCTGGAAAGGG 0: 1
1: 0
2: 2
3: 21
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000395593 Original CRISPR GGAGACAGTATGTGTGAAAC AGG (reversed) Intronic
900382925 1:2394014-2394036 GGAAACAGTCTGAGTAAAACGGG + Intronic
901261476 1:7874883-7874905 GGAGAGAGTGTGTGTGAAGAAGG - Intergenic
903016989 1:20367550-20367572 GGGCACAGCATGGGTGAAACAGG - Intergenic
904233488 1:29097282-29097304 AGAGACAGTATTTGGAAAACTGG - Intronic
905714925 1:40141069-40141091 GGAGACAATAAGTATGAAAAGGG - Intergenic
906542598 1:46599316-46599338 AGAGACAGGATGTGCCAAACAGG + Intronic
907082299 1:51634939-51634961 AGAAACAGTATGGGGGAAACTGG + Intronic
908849703 1:68363476-68363498 GGAGATAGCATGTGTGAACATGG + Intergenic
910839803 1:91550023-91550045 GGAGACAGTATGTGGTATAGTGG - Intergenic
914895260 1:151665512-151665534 GTAGGCTGAATGTGTGAAACTGG + Intronic
915083716 1:153369947-153369969 GGAGACAGTGTATGGGAAGCTGG - Intergenic
916244511 1:162673926-162673948 AGAGAGAGTATGTGTAAAAAGGG - Intronic
918106549 1:181420135-181420157 GGAGACAGGATTTGTAAAGCTGG - Intronic
920873377 1:209812632-209812654 GGAGACAATATGTTTCAAAAGGG - Intergenic
922489034 1:226000400-226000422 GGTGGCAGTATGTGCGAAAATGG + Intergenic
923908902 1:238417467-238417489 GAAAACAGTATAAGTGAAACCGG - Intergenic
924216107 1:241824157-241824179 GGAGACAATTTGAGTGACACTGG - Intergenic
1063376993 10:5560367-5560389 CCAGACAGTGTGTGTGAGACAGG + Intergenic
1063873842 10:10450814-10450836 GAAAACAGTTTGTGTGAAAATGG + Intergenic
1064093519 10:12405691-12405713 GGAGCCAGTATCTATGAGACAGG + Intronic
1066326839 10:34368711-34368733 GGAGAAAGTATTTGCAAAACTGG + Intronic
1066574957 10:36815163-36815185 GGATACATTATGTGGGAAACAGG - Intergenic
1068502854 10:57862119-57862141 TGAGACAATATGGATGAAACTGG - Intergenic
1068894076 10:62180390-62180412 GAAGACAATGTCTGTGAAACTGG + Intergenic
1072376460 10:94821547-94821569 TGAGACAGTTTCTGTGAAATTGG + Intronic
1072956057 10:99888932-99888954 GGAGTCCGCATGTGTGAAAGTGG - Exonic
1073734877 10:106334550-106334572 GCAGGCACTATGTGTGACACAGG + Intergenic
1074636532 10:115324709-115324731 GGAGACACTATCTATGAAAAAGG - Intronic
1075262704 10:120976886-120976908 GGAGAAATTATGTGTGAGTCTGG - Intergenic
1075293581 10:121252560-121252582 GGAGACAGCCTGTGTTTAACGGG - Intergenic
1075471299 10:122692034-122692056 AGAGACAGCATGTGTGGAAATGG - Intergenic
1076173812 10:128348035-128348057 GGAGAAAGTATTTGTGACATTGG - Intergenic
1077121158 11:909253-909275 GAACACAGTGTGTGTGAACCTGG - Intronic
1079745108 11:24116984-24117006 TGACACAGCATGCGTGAAACTGG + Intergenic
1083112617 11:60426549-60426571 GGAGACATTAAGAGTGACACTGG + Intergenic
1083485478 11:62980911-62980933 GGAGACACAATGGGTGAAAGAGG - Intronic
1083622200 11:64054785-64054807 GGAGACAAGATGAGTGACACAGG - Intronic
1087413398 11:97821725-97821747 GAAGTCATTATGTCTGAAACAGG - Intergenic
1087822053 11:102723578-102723600 GGAGCAAGCATGTGTGAAAAGGG + Intronic
1087842527 11:102935121-102935143 GAAGACTTTATGTGAGAAACAGG + Intergenic
1088412477 11:109550193-109550215 GGAGAAAGAATGGGTGAACCCGG + Intergenic
1091412704 12:254608-254630 GGAGACAGAAAATGAGAAACTGG - Intronic
1096748319 12:53743087-53743109 GGTGCCAGTATGTGGGGAACAGG - Intergenic
1098851491 12:75601366-75601388 GGAGACAGCAATGGTGAAACAGG - Intergenic
1105817630 13:24051447-24051469 GGTGCAAGGATGTGTGAAACTGG - Intronic
1105843961 13:24279212-24279234 GGAGCCAGTGTGTGTGTACCTGG + Intronic
1108878690 13:55081840-55081862 GGTGACAGAATGTGTGGAGCTGG - Intergenic
1109128112 13:58544434-58544456 GGACACATTGTGTCTGAAACAGG - Intergenic
1109201355 13:59435066-59435088 GGAGACAGTGGGAGTGAGACTGG - Intergenic
1109308893 13:60669662-60669684 GGTGTCATTATGTGTGAAACGGG + Intergenic
1112426085 13:99302560-99302582 GGACCCAGTATGTGTGACACTGG - Intronic
1113714030 13:112490041-112490063 AAAGACAGTATGTGTGAAAGTGG + Intronic
1114861436 14:26528148-26528170 GGATACAGTATGTGAGGAAGTGG - Intronic
1115160617 14:30389769-30389791 GGTGACAGGCTGTGTGGAACAGG + Intergenic
1115712622 14:36067553-36067575 GGAGGCAGGGTGTGTGAAAGAGG - Intergenic
1117370680 14:55075763-55075785 AAAGACAGTCTGAGTGAAACTGG - Intergenic
1120063946 14:80017956-80017978 GGAGGCAGTGTCTGTGAATCCGG - Intergenic
1122696077 14:103552904-103552926 GGAGACAGAAGGTGGGGAACTGG + Intergenic
1122855930 14:104560034-104560056 GGAGCCTGTCTGTGTGAAGCCGG - Intronic
1122869421 14:104629414-104629436 AGAGAAAGTATGTGTCAACCTGG + Intergenic
1123797817 15:23791120-23791142 GAAGTCAGTGTGTCTGAAACTGG - Intergenic
1124250001 15:28100945-28100967 GGAGACAGTATTTCTGGGACGGG - Intergenic
1126102290 15:45126272-45126294 GGAGACAGTATAGGTGGAACCGG - Intronic
1127174262 15:56337204-56337226 GGATATAGAATGTGTGGAACAGG - Intronic
1128141489 15:65303932-65303954 GGAGACACGAGGTCTGAAACTGG + Intergenic
1128274453 15:66340991-66341013 AGAGACAGTGTGTGTGAGAGAGG - Intronic
1128509493 15:68304631-68304653 GGAGACAGTCGGTGTGAGCCTGG - Intronic
1128738394 15:70066467-70066489 TGAGAAATTATTTGTGAAACGGG - Intronic
1129412540 15:75358131-75358153 GGAGACTGCTTGTGTGGAACAGG - Intronic
1130888704 15:88115314-88115336 TGAGCCATTATGTGTGAAAATGG - Intronic
1131962612 15:97805523-97805545 GGTGACAGTATTTGTGAACAGGG - Intergenic
1134168295 16:11948038-11948060 GGAGACAGGATGTGGATAACGGG - Intronic
1138860679 16:60751978-60752000 TGAGACTTTATGTGGGAAACAGG + Intergenic
1142177456 16:88651620-88651642 GGGGACAGGATGTGTACAACTGG + Intergenic
1142871214 17:2822234-2822256 TGAGGCTGTATGTGTGAACCTGG - Intronic
1144136994 17:12305091-12305113 GGTGACAGAATATGTGAAGCTGG + Intergenic
1146272251 17:31492139-31492161 GGAGACAGCCTGGGTGACACAGG - Intronic
1148447148 17:47744664-47744686 GGAGAAGGAATGTGTGAAACAGG + Intronic
1150835195 17:68557502-68557524 GAAGACAGCATCTGTGAACCGGG + Intronic
1151321892 17:73357535-73357557 GGTGTCAGGATGGGTGAAACCGG + Intronic
1151647662 17:75444489-75444511 GGAGACACATTGTTTGAAACAGG - Intronic
1152403658 17:80084303-80084325 AGAGAGAGTGTGTGTGAAGCAGG + Intronic
1153521542 18:5958956-5958978 GTAGACTGTATGTGTGAACGTGG + Intronic
1154370428 18:13756473-13756495 GGGGACAGCATGAGTGATACTGG + Intronic
1156333775 18:36150453-36150475 GGAGACAGTATGGGTGTTTCAGG + Intronic
1156567297 18:38207316-38207338 GGACAAAATATGTGTAAAACAGG - Intergenic
1157141649 18:45113926-45113948 GGAGAAAGTCTGAGTGAATCTGG + Intergenic
1164108539 19:22133067-22133089 GGAGACAGTATCTCAGCAACTGG - Intergenic
1165186168 19:34024089-34024111 GGAGACAGCATAAGTGAAGCGGG - Intergenic
1165723417 19:38095739-38095761 GGCGACAGTAAGTGGGACACTGG - Intronic
1166111464 19:40625826-40625848 GGAGACAGCATGTGTCAGAGTGG - Intronic
925198300 2:1945504-1945526 GGACACAGTGTGTGTGGACCAGG + Intronic
928843612 2:35641647-35641669 GGAGACACGAGGTGAGAAACAGG + Intergenic
931690227 2:64829401-64829423 GGAGACAGTGTGTGTAAAGATGG - Intergenic
932470267 2:71950602-71950624 GGAGACTGTAAGGATGAAACTGG + Intergenic
934846027 2:97661889-97661911 GGAAACAGTATTTGGGAATCTGG + Exonic
936101995 2:109590273-109590295 GGAGAAAGTTTGTGTGCACCAGG - Intronic
936687568 2:114846225-114846247 TGAGACAGCATTTGTGAAACTGG - Intronic
939739518 2:145888057-145888079 CTAGAGAGTATGTGTGAGACTGG - Intergenic
940015080 2:149095767-149095789 GGAGACAGAAAGTGGGAGACAGG + Intronic
940104412 2:150082149-150082171 GAAGACAATATGGGTGATACTGG - Intergenic
941970559 2:171346459-171346481 TGAGACAATATGTGAGAAATGGG + Intronic
943503382 2:188721212-188721234 TGAGACAATCTGTGTGAATCTGG + Intergenic
948131858 2:235607003-235607025 TGAGATAATATGTGTGAAACAGG - Intronic
1168912369 20:1459313-1459335 GGAGAAAGCATGTGTGAAGGGGG - Intronic
1170028689 20:11920553-11920575 GGCACCAGTATGTGTTAAACAGG + Intronic
1171451659 20:25240027-25240049 GGAGAGGGTATATGTTAAACGGG - Intergenic
1175725909 20:61318139-61318161 GGTGGCAGGATGTGTGAAAGGGG + Intronic
1175865012 20:62170867-62170889 GGAGCCAGTTTGTAGGAAACGGG - Intronic
1183014166 22:34972385-34972407 TGAGACAGCATATGTGAAATTGG + Intergenic
1184808721 22:46813892-46813914 GCAGACAGTATTTGGGAAAGTGG + Intronic
949444782 3:4122392-4122414 GGAGAAGGTATGTGGGAAATAGG + Intronic
953217986 3:40939101-40939123 GTAGCCAGTATGTGCAAAACAGG - Intergenic
956356475 3:68398480-68398502 CCAGACAGTATTTGTGAAAATGG - Intronic
956391347 3:68775865-68775887 CTGGACAGTATGTGTGGAACAGG - Intronic
957986396 3:87577016-87577038 GGAGAGGCTATGTGTGAAATTGG + Intergenic
958156197 3:89759243-89759265 GGTGTCATTATGTGTGAAATGGG + Intergenic
959508053 3:107177109-107177131 AGAGAGAGTGTGTGTGAAGCAGG - Intergenic
961438213 3:126933903-126933925 AGAGACAGTATGTGTGGAGAAGG - Intronic
961486857 3:127222739-127222761 GAAGACAGTCTGGGTGAAACCGG + Intergenic
961514547 3:127424558-127424580 GGAGGCAGTGTGTGTGAACAGGG - Intergenic
961514552 3:127424585-127424607 GGAGGCAGTATGTGTGAACAGGG - Intergenic
962364047 3:134765675-134765697 GGAGAGAGTCTGTGTGAGAGAGG + Intronic
962710417 3:138081311-138081333 GGAGACTGTATATGCCAAACAGG + Intronic
963281240 3:143386451-143386473 GGAGACAGAGTGAGTGACACAGG - Intronic
963573842 3:147033624-147033646 TGAGACAGGATGTCTAAAACTGG - Intergenic
964682210 3:159354595-159354617 GGAAAGAGTATGGGTGAAAATGG + Intronic
965476144 3:169157869-169157891 AGAGAAATTATGTGTGAATCAGG - Intronic
967475415 3:189911018-189911040 GGAGGGAGTTTCTGTGAAACAGG - Intergenic
968393120 4:209309-209331 GCACTCAGTATGTGTGGAACTGG + Intergenic
968722794 4:2220069-2220091 GGAGACAGTATGTTGATAACTGG - Intronic
969962186 4:10956219-10956241 TGAGACAGCATGTGTGAACCTGG + Intergenic
970695715 4:18674549-18674571 TTATACATTATGTGTGAAACGGG + Intergenic
970935205 4:21561619-21561641 GAAGACAGTATGCATAAAACCGG - Intronic
971108596 4:23556398-23556420 GGAGACAGTTTGAATGAAGCAGG + Intergenic
972204283 4:36753331-36753353 GGAGACTGTATGTTAGAAAATGG + Intergenic
972421451 4:38891167-38891189 GGAGTCACTATGAGTGAAGCAGG + Intronic
974379552 4:61120961-61120983 GGAGACAGTCTATGTAAAAGGGG - Intergenic
975353368 4:73370460-73370482 GAAGTCAGTATGTCTGAAATAGG - Intergenic
976071730 4:81248409-81248431 GGAGAAGGAATGTGTGATACTGG - Intergenic
977347952 4:95841015-95841037 GGACACAGTATGAGTGATCCTGG + Exonic
979045229 4:115854090-115854112 GGTGTCATTATGTGTGAAATGGG - Intergenic
981666266 4:147230557-147230579 GGAGGCAGCATGTGAAAAACAGG - Intergenic
984848238 4:184126374-184126396 AGAGGCAGTATGTGTCAAAGTGG + Intronic
986718061 5:10538230-10538252 GGAGACAGTGTGAGAGAGACTGG + Intergenic
986730879 5:10634071-10634093 GGAGACAATCTGTGTGTAAAAGG - Intronic
991258357 5:64639747-64639769 AGAGCCAGAATGTGTGATACAGG - Intergenic
994491146 5:100445227-100445249 GGAGGCAGGATGTGGGAAAGCGG + Intergenic
996591729 5:125155544-125155566 GAGAACAGTATGGGTGAAACTGG + Intergenic
996726693 5:126678909-126678931 GGAAACAGTACATCTGAAACTGG + Intergenic
997382010 5:133444920-133444942 GGAGACAGTGGGGGTTAAACAGG - Intronic
997642222 5:135456710-135456732 GGAGCCAGGCTGAGTGAAACCGG - Intergenic
998803085 5:145890878-145890900 GGTGTCATTATGTGTGAGACAGG - Intergenic
998906093 5:146906966-146906988 GGAGACAGGATGAGTAACACAGG + Intronic
1000123744 5:158223592-158223614 GAAGACAGTAAGTGTTAAAATGG - Intergenic
1000395593 5:160771834-160771856 GGAGACAGTATGTGTGAAACAGG - Intronic
1000964762 5:167642852-167642874 GGATATAGTATGTGAGAAAGGGG + Intronic
1001000090 5:167997282-167997304 TCATACAGTATGTGAGAAACTGG - Intronic
1001700778 5:173705342-173705364 GGAGACAGGATGGGGGAGACCGG - Intergenic
1002320151 5:178370358-178370380 TGAGACAATATGTGTGAACCTGG + Intronic
1002688661 5:181035641-181035663 GGAGAGAGTGTGGATGAAACAGG + Intergenic
1007354497 6:41302866-41302888 GGAGACAGAGTGAGTGAAAGGGG - Intergenic
1007626916 6:43251889-43251911 GGAGAGAGTATGTGGGCAAAAGG - Intronic
1010265343 6:73859424-73859446 AGAGACAGGTTGTGTGAACCTGG - Intergenic
1011320410 6:86085809-86085831 GGTGTCATTATGTGTGAAATTGG + Intergenic
1011397724 6:86927493-86927515 GCAGCCAGTATGTGGCAAACTGG - Intergenic
1011767559 6:90639424-90639446 GGAGACAGAATGGAAGAAACTGG - Intergenic
1014087245 6:117361007-117361029 AGAGACAATGTATGTGAAACTGG - Intronic
1016134001 6:140515877-140515899 GTAGGCAGTATGTGTAATACAGG + Intergenic
1020084706 7:5303974-5303996 GGACACAGCAGGGGTGAAACAGG - Exonic
1020445734 7:8265457-8265479 GGAGAGAGTATGGGTGAATAGGG + Intergenic
1022158426 7:27683367-27683389 GAAGACAGTATCTGTGAACCGGG - Intergenic
1025209598 7:57013226-57013248 GGACACAGCAGGGGTGAAACAGG + Intergenic
1025662353 7:63563624-63563646 GGACACAGCAGGGGTGAAACAGG - Intergenic
1026535137 7:71232971-71232993 GGAGACAATATGTGTGAACTTGG - Intronic
1028937171 7:96478970-96478992 GGAGACAGTGAGTGTTAAAGGGG + Intergenic
1029781544 7:102739434-102739456 TGAGACAGTTTATGTAAAACTGG + Intergenic
1031183902 7:118451655-118451677 GGACACAGAATGTGAGACACTGG - Intergenic
1032278922 7:130485707-130485729 GGTGACAGTGTGTGGGAGACAGG + Intergenic
1032667317 7:134049483-134049505 GGAAACAGAATGTGTGAACTGGG - Intronic
1035407528 7:158609417-158609439 GGAGAGAGTGTGTGTGAAGGAGG + Intergenic
1036687666 8:10922785-10922807 GGAGAGAGTATGTGTGCATGTGG + Intronic
1038195349 8:25361868-25361890 GGACACAGTATGTGAGAGACAGG - Intronic
1039492868 8:37960924-37960946 TGAGACACTGTGTGTGAAAGTGG - Intergenic
1040118854 8:43657940-43657962 AAAGAAACTATGTGTGAAACTGG + Intergenic
1040436879 8:47399514-47399536 GGAGAGAGAATCTGTGACACGGG + Intronic
1040793461 8:51262355-51262377 TGAGACAATATGAATGAAACTGG + Intergenic
1041851651 8:62399935-62399957 GGAGACAGTGTGGATGACACAGG + Intronic
1042957110 8:74262591-74262613 GGAGAAAGTATTTGTGATAATGG - Intronic
1046409622 8:113823367-113823389 TGATTCATTATGTGTGAAACAGG - Intergenic
1047327628 8:123854780-123854802 GGAGACTGTGGGAGTGAAACTGG + Intronic
1049389116 8:142359050-142359072 GGAGGCAGCCTGGGTGAAACAGG - Intronic
1049430958 8:142564632-142564654 AGAGACAGAAAATGTGAAACCGG + Intergenic
1051644506 9:19254432-19254454 GGTGACATTATGGATGAAACTGG + Intronic
1057070550 9:92095731-92095753 GGTGACAAAATGTGGGAAACTGG + Intronic
1058070367 9:100595493-100595515 GGAGACAGTGTGGTTGAAATGGG + Intergenic
1058474053 9:105313010-105313032 GGAGACTGAATAGGTGAAACGGG - Intronic
1059586148 9:115608898-115608920 GGAAACAGTATGTGGTATACAGG - Intergenic
1060239875 9:121893801-121893823 GGAGACATTCTGTCAGAAACTGG + Intronic
1060798082 9:126526200-126526222 GGAGACAGCAAGAGTGAAAGAGG - Intergenic
1186906370 X:14115251-14115273 AGAAGCAGTATGTATGAAACAGG - Intergenic
1187445562 X:19357691-19357713 GGACACAGTATGAGTGACCCTGG + Exonic
1188656267 X:32700264-32700286 TGAGACAGCATGTGTAAATCTGG + Intronic
1189321326 X:40089398-40089420 GGAGACAGTATGTGAAAATCAGG - Intronic
1190157587 X:48006357-48006379 GGAGACAGTAGGAGTGAATGGGG + Intronic
1190173357 X:48129242-48129264 GGAGACAGTAGGAGTGAATGGGG + Intergenic
1190578705 X:51869356-51869378 GGACAGAGTATGTGTGGAAATGG + Intronic
1194819610 X:98489661-98489683 TGAGACAGTATATATGAGACTGG + Intergenic
1197072508 X:122316171-122316193 GGACAAAGTGTGTGTGAATCTGG + Intergenic
1198828152 X:140720211-140720233 GGAGACAGTTTGTGTGTTAAAGG - Intergenic
1199918955 X:152375961-152375983 GGAGTCAGGATATGTGAAACTGG - Intronic
1200294664 X:154907069-154907091 GGAGAAAGTATGATTGAAAAGGG - Intronic