ID: 1000408973

View in Genome Browser
Species Human (GRCh38)
Location 5:160918146-160918168
Sequence CATAGTGTCTGGCACCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000408973_1000408979 10 Left 1000408973 5:160918146-160918168 CCTATGGGGTGCCAGACACTATG No data
Right 1000408979 5:160918179-160918201 AGGGAAAGTGGAGATAGAGCAGG No data
1000408973_1000408977 -9 Left 1000408973 5:160918146-160918168 CCTATGGGGTGCCAGACACTATG No data
Right 1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG No data
1000408973_1000408978 -2 Left 1000408973 5:160918146-160918168 CCTATGGGGTGCCAGACACTATG No data
Right 1000408978 5:160918167-160918189 TGTTAGGTGCTAAGGGAAAGTGG No data
1000408973_1000408976 -10 Left 1000408973 5:160918146-160918168 CCTATGGGGTGCCAGACACTATG No data
Right 1000408976 5:160918159-160918181 AGACACTATGTTAGGTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000408973 Original CRISPR CATAGTGTCTGGCACCCCAT AGG (reversed) Intergenic
No off target data available for this crispr