ID: 1000408977

View in Genome Browser
Species Human (GRCh38)
Location 5:160918160-160918182
Sequence GACACTATGTTAGGTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000408973_1000408977 -9 Left 1000408973 5:160918146-160918168 CCTATGGGGTGCCAGACACTATG No data
Right 1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000408977 Original CRISPR GACACTATGTTAGGTGCTAA GGG Intergenic
No off target data available for this crispr