ID: 1000409568

View in Genome Browser
Species Human (GRCh38)
Location 5:160923988-160924010
Sequence CCCTTGATGAAAGGGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000409564_1000409568 -9 Left 1000409564 5:160923974-160923996 CCTATTGGGACATTCCCTTGATG No data
Right 1000409568 5:160923988-160924010 CCCTTGATGAAAGGGTTGTCTGG No data
1000409559_1000409568 14 Left 1000409559 5:160923951-160923973 CCAACACTCTGCCCTCATGTTTA No data
Right 1000409568 5:160923988-160924010 CCCTTGATGAAAGGGTTGTCTGG No data
1000409563_1000409568 2 Left 1000409563 5:160923963-160923985 CCTCATGTTTACCTATTGGGACA No data
Right 1000409568 5:160923988-160924010 CCCTTGATGAAAGGGTTGTCTGG No data
1000409558_1000409568 25 Left 1000409558 5:160923940-160923962 CCTTGGAGAGACCAACACTCTGC No data
Right 1000409568 5:160923988-160924010 CCCTTGATGAAAGGGTTGTCTGG No data
1000409562_1000409568 3 Left 1000409562 5:160923962-160923984 CCCTCATGTTTACCTATTGGGAC No data
Right 1000409568 5:160923988-160924010 CCCTTGATGAAAGGGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000409568 Original CRISPR CCCTTGATGAAAGGGTTGTC TGG Intergenic
No off target data available for this crispr