ID: 1000413494

View in Genome Browser
Species Human (GRCh38)
Location 5:160958971-160958993
Sequence AATGTTAATAAGAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000413491_1000413494 13 Left 1000413491 5:160958935-160958957 CCTGGATTATCTGTGTAGATCTG No data
Right 1000413494 5:160958971-160958993 AATGTTAATAAGAGGGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000413494 Original CRISPR AATGTTAATAAGAGGGATGC TGG Intergenic
No off target data available for this crispr