ID: 1000416970

View in Genome Browser
Species Human (GRCh38)
Location 5:160993873-160993895
Sequence AGTTATCTACAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000416970_1000416972 4 Left 1000416970 5:160993873-160993895 CCTGCCATCTTCTGTAGATAACT No data
Right 1000416972 5:160993900-160993922 TCTTTTTGAGAGACAGCTCTTGG No data
1000416970_1000416974 16 Left 1000416970 5:160993873-160993895 CCTGCCATCTTCTGTAGATAACT No data
Right 1000416974 5:160993912-160993934 ACAGCTCTTGGCCTGTTATTGGG No data
1000416970_1000416973 15 Left 1000416970 5:160993873-160993895 CCTGCCATCTTCTGTAGATAACT No data
Right 1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG No data
1000416970_1000416976 25 Left 1000416970 5:160993873-160993895 CCTGCCATCTTCTGTAGATAACT No data
Right 1000416976 5:160993921-160993943 GGCCTGTTATTGGGCTTTGGTGG No data
1000416970_1000416975 22 Left 1000416970 5:160993873-160993895 CCTGCCATCTTCTGTAGATAACT No data
Right 1000416975 5:160993918-160993940 CTTGGCCTGTTATTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000416970 Original CRISPR AGTTATCTACAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr