ID: 1000416973

View in Genome Browser
Species Human (GRCh38)
Location 5:160993911-160993933
Sequence GACAGCTCTTGGCCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000416969_1000416973 16 Left 1000416969 5:160993872-160993894 CCCTGCCATCTTCTGTAGATAAC No data
Right 1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG No data
1000416971_1000416973 11 Left 1000416971 5:160993877-160993899 CCATCTTCTGTAGATAACTACTC No data
Right 1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG No data
1000416970_1000416973 15 Left 1000416970 5:160993873-160993895 CCTGCCATCTTCTGTAGATAACT No data
Right 1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000416973 Original CRISPR GACAGCTCTTGGCCTGTTAT TGG Intergenic
No off target data available for this crispr