ID: 1000423263

View in Genome Browser
Species Human (GRCh38)
Location 5:161061383-161061405
Sequence GAGCCCTAATCAATAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000423263_1000423264 -7 Left 1000423263 5:161061383-161061405 CCATGGGTTATTGATTAGGGCTC No data
Right 1000423264 5:161061399-161061421 AGGGCTCTCTCTACTGTTACAGG No data
1000423263_1000423265 -4 Left 1000423263 5:161061383-161061405 CCATGGGTTATTGATTAGGGCTC No data
Right 1000423265 5:161061402-161061424 GCTCTCTCTACTGTTACAGGTGG No data
1000423263_1000423266 15 Left 1000423263 5:161061383-161061405 CCATGGGTTATTGATTAGGGCTC No data
Right 1000423266 5:161061421-161061443 GTGGAGTCCTTAGACTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000423263 Original CRISPR GAGCCCTAATCAATAACCCA TGG (reversed) Intergenic
No off target data available for this crispr