ID: 1000426802

View in Genome Browser
Species Human (GRCh38)
Location 5:161100751-161100773
Sequence TACCTGTGTGTTCACCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000426802_1000426804 0 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426804 5:161100774-161100796 AGAAAGTTAATATGTGGTTGAGG No data
1000426802_1000426809 9 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426809 5:161100783-161100805 ATATGTGGTTGAGGTGGGGTGGG No data
1000426802_1000426810 20 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426810 5:161100794-161100816 AGGTGGGGTGGGAAAATGATTGG No data
1000426802_1000426811 23 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426811 5:161100797-161100819 TGGGGTGGGAAAATGATTGGTGG No data
1000426802_1000426812 24 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426812 5:161100798-161100820 GGGGTGGGAAAATGATTGGTGGG No data
1000426802_1000426807 5 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426807 5:161100779-161100801 GTTAATATGTGGTTGAGGTGGGG No data
1000426802_1000426808 8 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426808 5:161100782-161100804 AATATGTGGTTGAGGTGGGGTGG No data
1000426802_1000426805 3 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426805 5:161100777-161100799 AAGTTAATATGTGGTTGAGGTGG No data
1000426802_1000426806 4 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426806 5:161100778-161100800 AGTTAATATGTGGTTGAGGTGGG No data
1000426802_1000426803 -6 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426803 5:161100768-161100790 CAGGTAAGAAAGTTAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000426802 Original CRISPR TACCTGTGTGTTCACCCTCA TGG (reversed) Intergenic
No off target data available for this crispr