ID: 1000426809

View in Genome Browser
Species Human (GRCh38)
Location 5:161100783-161100805
Sequence ATATGTGGTTGAGGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000426802_1000426809 9 Left 1000426802 5:161100751-161100773 CCATGAGGGTGAACACACAGGTA No data
Right 1000426809 5:161100783-161100805 ATATGTGGTTGAGGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000426809 Original CRISPR ATATGTGGTTGAGGTGGGGT GGG Intergenic
No off target data available for this crispr