ID: 1000427693

View in Genome Browser
Species Human (GRCh38)
Location 5:161112030-161112052
Sequence CTGTATGAGTAGGGGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000427693_1000427697 -2 Left 1000427693 5:161112030-161112052 CCTTCTTACCCCTACTCATACAG No data
Right 1000427697 5:161112051-161112073 AGATGAACTACACTGACTCTAGG No data
1000427693_1000427699 3 Left 1000427693 5:161112030-161112052 CCTTCTTACCCCTACTCATACAG No data
Right 1000427699 5:161112056-161112078 AACTACACTGACTCTAGGAAGGG No data
1000427693_1000427698 2 Left 1000427693 5:161112030-161112052 CCTTCTTACCCCTACTCATACAG No data
Right 1000427698 5:161112055-161112077 GAACTACACTGACTCTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000427693 Original CRISPR CTGTATGAGTAGGGGTAAGA AGG (reversed) Intergenic
No off target data available for this crispr