ID: 1000433411

View in Genome Browser
Species Human (GRCh38)
Location 5:161179310-161179332
Sequence ACGGAGAGCACAGTGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000433403_1000433411 14 Left 1000433403 5:161179273-161179295 CCACATGCTATGGAGAGAGAATC No data
Right 1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG No data
1000433400_1000433411 25 Left 1000433400 5:161179262-161179284 CCCAGGAACAGCCACATGCTATG No data
Right 1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG No data
1000433401_1000433411 24 Left 1000433401 5:161179263-161179285 CCAGGAACAGCCACATGCTATGG No data
Right 1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG No data
1000433398_1000433411 27 Left 1000433398 5:161179260-161179282 CCCCCAGGAACAGCCACATGCTA No data
Right 1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG No data
1000433399_1000433411 26 Left 1000433399 5:161179261-161179283 CCCCAGGAACAGCCACATGCTAT No data
Right 1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000433411 Original CRISPR ACGGAGAGCACAGTGATGGT GGG Intergenic
No off target data available for this crispr