ID: 1000433730

View in Genome Browser
Species Human (GRCh38)
Location 5:161182153-161182175
Sequence CTTTGTAGTTATATGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000433730_1000433733 27 Left 1000433730 5:161182153-161182175 CCTAGATACATATAACTACAAAG No data
Right 1000433733 5:161182203-161182225 GAATAGACAAATAAGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000433730 Original CRISPR CTTTGTAGTTATATGTATCT AGG (reversed) Intergenic
No off target data available for this crispr