ID: 1000447682

View in Genome Browser
Species Human (GRCh38)
Location 5:161344302-161344324
Sequence GAAAATACAGAGATGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 833
Summary {0: 1, 1: 0, 2: 9, 3: 92, 4: 731}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000447675_1000447682 21 Left 1000447675 5:161344258-161344280 CCTGGTTTCCTTAAATAGTCTAT 0: 1
1: 0
2: 0
3: 20
4: 199
Right 1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG 0: 1
1: 0
2: 9
3: 92
4: 731
1000447676_1000447682 13 Left 1000447676 5:161344266-161344288 CCTTAAATAGTCTATAACCTACA 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG 0: 1
1: 0
2: 9
3: 92
4: 731
1000447677_1000447682 -4 Left 1000447677 5:161344283-161344305 CCTACAATCACCAATAGCAGAAA 0: 1
1: 0
2: 1
3: 20
4: 208
Right 1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG 0: 1
1: 0
2: 9
3: 92
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000447682 Original CRISPR GAAAATACAGAGATGGGGCT AGG Intronic
900251582 1:1673208-1673230 GAAAACACAAAAATGAGGCTGGG + Intronic
900261943 1:1735744-1735766 GAAAACACAAAAATGAGGCTGGG + Intronic
900310925 1:2032760-2032782 GACAAGGCAGAGATGGGGCCAGG - Intergenic
900700793 1:4047531-4047553 GAGAACACAGAGATGGGGAAGGG + Intergenic
900894969 1:5477030-5477052 GAAAGTACAGAGCTGGTGCTGGG - Intergenic
901440466 1:9275008-9275030 AAAAATCCAGAGTTGGGGCCGGG - Intergenic
901697377 1:11018482-11018504 TAAAAAAGAGAGATGGGGCCAGG - Intronic
901752737 1:11421394-11421416 GAAAATACAGTGAAGGAGCCAGG - Intergenic
902333766 1:15743289-15743311 GAAAATACGGCGAAGAGGCTGGG - Intronic
902344310 1:15804791-15804813 TAAAAAACACAAATGGGGCTGGG - Intergenic
902526224 1:17059446-17059468 GAAAAATCATAGATGGGACTGGG - Intergenic
902675372 1:18005078-18005100 GAAGAAACAGAGAAGGGGCTTGG + Intergenic
903696815 1:25213813-25213835 AAAAATACAGAACTGGGGCCAGG + Intergenic
903991561 1:27274329-27274351 GAAAATACAGAGAACTGGCTGGG + Intronic
904219377 1:28952581-28952603 GAAAATACAGAAAAGGGGAAAGG + Intronic
905022587 1:34828102-34828124 GAAATTAGAGAGGTGGGGATGGG - Intronic
905300817 1:36985223-36985245 GAAGAGACTGAGATGGGGCTGGG + Intronic
905591640 1:39168921-39168943 GAAAATACTGAGTTTGGGCTGGG - Intronic
906287389 1:44596264-44596286 AAAAAGACAGAGAAGGGGCTGGG + Intronic
906497350 1:46314373-46314395 AAAAAAAAAGAGAAGGGGCTGGG + Intronic
906631243 1:47370210-47370232 TAAAAAACAGAGAAAGGGCTGGG - Intronic
907673565 1:56498448-56498470 GAAAATGTGGAGCTGGGGCTGGG - Intronic
908526088 1:64989029-64989051 TAAAATACAGAGATAAGGCTGGG + Intergenic
909260562 1:73483751-73483773 GAAAATACAGATATTAGTCTAGG - Intergenic
909552095 1:76909307-76909329 GTAAGTACAGAGATGGGTGTTGG - Intronic
909612591 1:77568758-77568780 GAAAATATAAAGATGGGATTGGG - Intronic
909615911 1:77607628-77607650 GAAAATACAGAGAGGAGGCCGGG + Intronic
909951157 1:81721995-81722017 GAAAATGCAGAGATAGGACCAGG + Intronic
910482887 1:87677441-87677463 GAAAGTAGAGAGATGGGTCAGGG + Intergenic
910735837 1:90456437-90456459 GAAAAGACAGTCATTGGGCTGGG + Intergenic
910747268 1:90587754-90587776 GAAAATACAATGATGGGGCTGGG + Intergenic
911844096 1:102726797-102726819 GAAAATACAAAGAAGTGGTTTGG - Intergenic
912064061 1:105713076-105713098 GTAAATCCATAAATGGGGCTGGG - Intergenic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
912713910 1:111968613-111968635 GAGATAACAGAGATGGGGCCGGG - Intronic
912917742 1:113833762-113833784 GTAAAGTCAGAGATGGGGGTGGG - Intronic
913013541 1:114709895-114709917 AAAAATACAAAGATTAGGCTGGG + Intronic
915156593 1:153881752-153881774 GAAAATAATGAGATGGGTTTAGG + Intronic
915470598 1:156123642-156123664 AAAAATGCAGGGGTGGGGCTTGG - Intronic
916585334 1:166144947-166144969 GAAAAGACAGAGATGGGGTGAGG + Intronic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
917812783 1:178676082-178676104 GAAAATACAAAAATTGGGCCAGG + Intergenic
917839606 1:178967012-178967034 GAAAATAGAGAAATGTGGCTGGG + Intergenic
917874918 1:179277619-179277641 GAAAATACAAATATAGGGCTGGG - Intergenic
918676156 1:187288750-187288772 GAAAAGACAGGGATGGGGAGAGG - Intergenic
918732105 1:188012086-188012108 GAAAGTACATAGATCGGTCTAGG + Intergenic
919163001 1:193855741-193855763 GAACATACAGAAATAGGGGTGGG + Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919951868 1:202372164-202372186 GAAAATATAATGAAGGGGCTGGG - Intronic
920148902 1:203887641-203887663 GGAAAAAAAGAGATGGGGATGGG - Intergenic
920255827 1:204653563-204653585 TAAAATACAGAGATTGGCCCGGG + Intronic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
920615293 1:207486387-207486409 GAAGTCACAGAGATGGGGGTGGG + Intronic
921204648 1:212838003-212838025 GAAGACAAAGAAATGGGGCTGGG + Intronic
921358832 1:214311958-214311980 GAAAAGACAGAGATGACCCTCGG - Intronic
921870336 1:220132819-220132841 GAAAAAGGAGACATGGGGCTGGG - Intronic
922310173 1:224381285-224381307 AAAAATACAAAAATGGGGCACGG + Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922497189 1:226067441-226067463 AAAAATACAGAGAGTGGGCCGGG + Intronic
922771524 1:228186538-228186560 GAAAAAACATAGAAGAGGCTGGG - Intergenic
922931032 1:229389892-229389914 CAAAATACAGACATTGAGCTAGG + Intergenic
922972596 1:229755474-229755496 GAAAATAGAGTCATGGGGCTAGG + Intergenic
923547655 1:234934579-234934601 TAAAAAACAGAAATAGGGCTGGG - Intergenic
923590355 1:235312676-235312698 AAAAAAACAGAAATGGGGCTGGG + Intronic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
923627723 1:235627883-235627905 TAAAATACAGATATGGGGCCGGG + Intronic
923672665 1:236054117-236054139 GAAAAAAAAGAGCTGGGGTTAGG + Intronic
923825576 1:237496107-237496129 TAAAATAGTGAGATGTGGCTGGG + Intronic
923913950 1:238481991-238482013 GAAAAGACAGAGAAGGGGAAAGG + Intergenic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063140309 10:3250902-3250924 GAGCACACAGAGATGGAGCTGGG + Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1064356923 10:14627476-14627498 AAGAATACAGAGGTGAGGCTGGG + Intronic
1064653550 10:17534337-17534359 AAAAATATACAGATGAGGCTGGG + Intergenic
1064807750 10:19156391-19156413 GAAAATAAAGAGGTGGGAATGGG - Intronic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1067175329 10:43941941-43941963 AAAAATACAGACGTGGGACTAGG + Intergenic
1067436135 10:46280082-46280104 AAAGATACAGAGATGTGGCCGGG - Intergenic
1067934947 10:50602225-50602247 GAAGAAGCAGAGATGGGGCAGGG - Intronic
1068054755 10:51997832-51997854 GAAAAGAGAGAGATGGGGAGGGG - Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1068849559 10:61721217-61721239 GAAAAAGCAGAGGTGGGGCCGGG - Intronic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1069755550 10:70772573-70772595 CCAAATACAAAGAAGGGGCTGGG + Intronic
1069851348 10:71407255-71407277 GCAATGACAGAGCTGGGGCTGGG + Intronic
1070171104 10:73933216-73933238 TAAAATGCATAGTTGGGGCTAGG + Intergenic
1070467526 10:76738642-76738664 CAAACTACAGAGAAGGGGCCTGG - Intergenic
1070496904 10:77032952-77032974 GAAAATACAAAGAGGAGGTTTGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071533312 10:86405814-86405836 GAAAGGACAGAAATGGTGCTGGG + Intergenic
1071712350 10:88061905-88061927 GGAAATACAGGGATAGGACTGGG + Intergenic
1071850774 10:89567908-89567930 GAAAATAAAGTAATGGGGCATGG + Intergenic
1072636553 10:97182066-97182088 TAAAATACAGAGCCAGGGCTGGG - Intronic
1072886955 10:99285629-99285651 GAAAATATATAAATGAGGCTGGG + Intergenic
1073156327 10:101349996-101350018 AAAAATACAGAAATTAGGCTGGG + Intergenic
1073524440 10:104166365-104166387 AAAAATACATAGAGGAGGCTGGG - Intronic
1073577120 10:104636089-104636111 TAAAATACGGAAATAGGGCTGGG + Intergenic
1073666528 10:105540354-105540376 GAAAAGACAGAGAAAGGGCCTGG + Intergenic
1073670612 10:105583536-105583558 GAAAAGACACAGGTGGGGTTGGG + Intergenic
1073725690 10:106227607-106227629 GATAAGACAGGGATGGGACTAGG - Intergenic
1075386452 10:122058877-122058899 AAAAACACACAGAGGGGGCTGGG - Intronic
1076567132 10:131406599-131406621 GAAGATACAGAGAAAGAGCTTGG - Intergenic
1076987271 11:247534-247556 GAAATTACTAAGGTGGGGCTGGG + Intronic
1077098061 11:808129-808151 AAAAAAAGTGAGATGGGGCTGGG + Intronic
1077533453 11:3107972-3107994 GGATATACAGAGGTGGGGGTGGG - Intronic
1077890002 11:6411794-6411816 GAGCTTACAGTGATGGGGCTTGG - Intronic
1078378838 11:10820995-10821017 TAAAAAACAGATATGGGGCTGGG - Intronic
1078601205 11:12732720-12732742 GAAAAGTCAGAGTTGGGACTAGG + Intronic
1079142332 11:17820206-17820228 GACAATGAAGAGAAGGGGCTTGG - Intronic
1079327442 11:19506259-19506281 GAAACTATAGGCATGGGGCTAGG + Intronic
1079392073 11:20031192-20031214 GAAATTCCAGAGAAGTGGCTTGG - Intronic
1079713013 11:23709588-23709610 GAAAATACACAGTCAGGGCTGGG + Intergenic
1080680671 11:34472987-34473009 GAAAATAGATATATCGGGCTGGG + Intergenic
1080769732 11:35329582-35329604 GAATATTCAGGGATGGGGCTTGG - Intronic
1080844827 11:36017682-36017704 AAAAATACAGTCATGGGGCATGG - Intronic
1082104780 11:48209848-48209870 CAAAATACATGGCTGGGGCTGGG + Intergenic
1082686145 11:56241838-56241860 GGAAGTACAGTGATGGGGGTTGG - Intergenic
1083253647 11:61483459-61483481 GAAATGAAAAAGATGGGGCTGGG - Intronic
1083257469 11:61505566-61505588 AAAAATACAGAGTTGGGGGTGGG + Intergenic
1083361796 11:62113965-62113987 GGAACTCCAGAGGTGGGGCTTGG + Intergenic
1084097411 11:66920747-66920769 GGAAATACAGGCATGAGGCTGGG + Intronic
1084168836 11:67390603-67390625 AAAAATACAGACCCGGGGCTGGG + Intronic
1084242109 11:67828835-67828857 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1085327623 11:75619003-75619025 GAAGATACAGACATGGGGAGGGG + Intronic
1085665818 11:78415339-78415361 AAATATACAGCCATGGGGCTGGG + Intronic
1086108277 11:83170231-83170253 GAAAAAACAGAGCTGGAGGTGGG - Intronic
1086376391 11:86204992-86205014 TAAAATACTGAGCTGTGGCTGGG - Intergenic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086484467 11:87283561-87283583 GAAAATAAATTAATGGGGCTGGG + Intronic
1087030985 11:93704062-93704084 AGAATTACAGAGATGGGGCCGGG - Intronic
1088076862 11:105860663-105860685 CAAAAATGAGAGATGGGGCTGGG + Intronic
1088432159 11:109770363-109770385 GAAAATACTGCAATTGGGCTTGG - Intergenic
1088967041 11:114733885-114733907 GAAAATATACACATGGGACTGGG - Intergenic
1089050824 11:115544301-115544323 GTTAATGAAGAGATGGGGCTGGG - Intergenic
1089154932 11:116394446-116394468 GAAAATGCAGAGAGGGGTCACGG - Intergenic
1089431416 11:118427799-118427821 AAAAATACAGATCTGGGACTTGG - Intronic
1089460282 11:118648981-118649003 GGAAATAATGAGAAGGGGCTGGG + Intronic
1089508024 11:118977922-118977944 AAAAATACAAAAATTGGGCTGGG + Intronic
1090319878 11:125833047-125833069 GAGAAGACAGATATGGGGCAGGG + Intergenic
1090349279 11:126097199-126097221 GAAAATACAAAAATTAGGCTGGG - Intergenic
1090463875 11:126915681-126915703 GAAAATACAAAGCTGAGCCTTGG - Intronic
1091219564 11:133922018-133922040 AGAAACACTGAGATGGGGCTGGG + Intronic
1091488228 12:910114-910136 GAACATAAAGAGAAGGGGGTGGG + Exonic
1091535253 12:1401227-1401249 AAAAATACAAAAATAGGGCTGGG - Intronic
1091721765 12:2819167-2819189 AAAAATACAAAAATTGGGCTGGG + Intronic
1092081937 12:5723594-5723616 GAAATTACAGAGAAGGGGCAGGG + Intronic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1092412358 12:8263534-8263556 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1092859459 12:12707877-12707899 TAAAATACAGAATTTGGGCTCGG - Intergenic
1093448434 12:19287297-19287319 TAAAATACTGATGTGGGGCTGGG - Intronic
1093766650 12:22971165-22971187 GAAAATCCTGAGATGGCTCTTGG - Intergenic
1093936598 12:25008304-25008326 GAAAATACTAAATTGGGGCTGGG + Intergenic
1094198489 12:27774726-27774748 GAAAATAAAAAGCAGGGGCTGGG + Intergenic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1095128557 12:38510284-38510306 CAAAATAAAGGGATGGGGCCAGG + Intergenic
1095220463 12:39607870-39607892 GAAAATTCAGTGTTTGGGCTGGG + Intronic
1095368309 12:41435491-41435513 AAAAATACAGAGTATGGGCTGGG + Intronic
1095635508 12:44428704-44428726 GAACATACAGGGATGGGTGTGGG + Intergenic
1096124241 12:49107967-49107989 AAAAATACAAAAATTGGGCTGGG + Intronic
1096725607 12:53559381-53559403 TAAAATACAGAAAATGGGCTGGG + Intronic
1097082644 12:56444189-56444211 AAGAATACAGAAATGAGGCTGGG - Intronic
1098048085 12:66422958-66422980 GAAAATTAAAACATGGGGCTAGG - Intronic
1098058530 12:66534987-66535009 GGAAAGACAGAGAGGGGGCTAGG - Intronic
1098097134 12:66970374-66970396 AAAATTACACAGATGAGGCTGGG - Intergenic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1102052548 12:109873337-109873359 GAAAAGCCAGAGCTGAGGCTGGG + Intronic
1102277172 12:111591372-111591394 AAAAATAAAGGGAGGGGGCTCGG + Intronic
1102372762 12:112396058-112396080 GAAAAGACACAGACTGGGCTGGG + Intergenic
1102590928 12:113956283-113956305 GAAAATACAGGGCTGGGGCCAGG + Intronic
1102695497 12:114796006-114796028 GAAAATATAGAAATGTGGCCAGG - Intergenic
1103110170 12:118270131-118270153 GAAAATACAGGACTGGGGCTTGG - Intronic
1104040581 12:125127737-125127759 GGAAAAACAGAAATGTGGCTGGG - Intronic
1104176446 12:126337389-126337411 AAAATTAGAAAGATGGGGCTGGG - Intergenic
1105936459 13:25104799-25104821 GAAAATACAAAGAACCGGCTGGG + Intergenic
1106090404 13:26587386-26587408 GAAACTACAGAAATGGCTCTTGG + Intronic
1106179273 13:27357167-27357189 AAAAATACTGAAAGGGGGCTGGG - Intergenic
1106911961 13:34472445-34472467 GAGAAAACAGAGGTGGGGGTGGG - Intergenic
1106947707 13:34847329-34847351 GAAAAAATACAGGTGGGGCTGGG - Intergenic
1106957529 13:34957222-34957244 GAAAATACAGGGTTAGGGCTAGG - Intronic
1107036258 13:35905592-35905614 GAAAATTCAGAGGTGGCCCTCGG - Intronic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1107597112 13:41974416-41974438 AAAAGTACATAGCTGGGGCTGGG - Intergenic
1108070464 13:46623858-46623880 TAAAAAACAGAGATGGGGAGGGG - Intronic
1108187976 13:47907559-47907581 GAAAACACTGACAAGGGGCTGGG + Intergenic
1108272466 13:48774877-48774899 GAGATTTCAGAGTTGGGGCTGGG - Intergenic
1108306113 13:49135148-49135170 GAAAATATATGAATGGGGCTGGG - Intronic
1108381640 13:49860317-49860339 TAAAAGAAATAGATGGGGCTTGG + Intergenic
1109221100 13:59641856-59641878 GAAATCACAGACATGGGGCTGGG + Intergenic
1110309541 13:74032649-74032671 GAAAATATAGAGAGAGGCCTGGG - Intronic
1110893271 13:80716457-80716479 GGAAGTACAGAGATGGGCCTAGG + Intergenic
1111101989 13:83599934-83599956 GAAAATGCAGAGAAGGGCCCGGG + Intergenic
1111562794 13:89973627-89973649 GAAAATACAGAGAAGTTACTAGG + Intergenic
1111599882 13:90459073-90459095 GAATCTAGAGAGATGGTGCTTGG - Intergenic
1111622605 13:90743895-90743917 GAAAATAGAGAGAAGGGGAAAGG - Intergenic
1111644218 13:91010037-91010059 AAAAATTCATAGATGGGTCTGGG + Intergenic
1111977812 13:94986036-94986058 AAAAATAAAAAGATAGGGCTGGG + Intergenic
1112278710 13:98044314-98044336 GCAAGTGCAGAGATGGGCCTAGG + Intergenic
1112531127 13:100204433-100204455 AAAAAGACAGCCATGGGGCTGGG - Intronic
1112776998 13:102855153-102855175 CACAAAACAGAGATTGGGCTTGG - Intronic
1114033586 14:18598385-18598407 AAAAATGCAAGGATGGGGCTGGG + Intergenic
1114078376 14:19177581-19177603 AAAAATGCAAGGATGGGGCTGGG + Intergenic
1114125113 14:19716966-19716988 AAAAATGCAAGGATGGGGCTGGG - Intergenic
1114683081 14:24503260-24503282 TAGAATACATGGATGGGGCTTGG + Intronic
1115147414 14:30241410-30241432 GAGCATACACAGATGGGGTTAGG - Intergenic
1115507669 14:34108485-34108507 GAAAATAAAGATTTGTGGCTGGG - Intronic
1115608816 14:35032786-35032808 CAAAATACAGAAATTAGGCTGGG + Intergenic
1115620162 14:35133212-35133234 GAAAATACACAGTTAGGGCTGGG - Intronic
1116375612 14:44196306-44196328 GAAACTTCAGGGAAGGGGCTTGG - Intergenic
1116849110 14:49891415-49891437 AAAAATAGAGAGGTGGGGTTGGG + Intergenic
1116852124 14:49919128-49919150 TAAAATACAAATATGGGGCCGGG + Intergenic
1117130613 14:52682910-52682932 AAAAAGACACAGATTGGGCTGGG + Intronic
1118100889 14:62601343-62601365 AAAAATAGACAAATGGGGCTGGG + Intergenic
1118205710 14:63721176-63721198 AAAAATACAGAAATTAGGCTGGG - Intronic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1118574140 14:67224553-67224575 GAAAGTAGAGAAATGGGGCCGGG - Intronic
1118890091 14:69901910-69901932 GAAAAGACAGAGTAGAGGCTGGG - Intronic
1119024037 14:71138354-71138376 GGGAATAAAGAGAGGGGGCTAGG + Intergenic
1119355432 14:74002300-74002322 GAAAAGACAGATATGGGAGTGGG + Intronic
1119459822 14:74791371-74791393 GAAAATAAAATGATGGGCCTTGG + Intronic
1119647158 14:76356150-76356172 GAAGAGTCAGAGAAGGGGCTAGG + Intronic
1119707166 14:76790212-76790234 CACAATACAGGCATGGGGCTGGG + Intronic
1119720251 14:76885253-76885275 GAGAAGGCAGAGGTGGGGCTGGG - Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120049182 14:79845511-79845533 GGAAATAGGGAGATGGGGGTGGG + Intronic
1120222746 14:81753162-81753184 GGAAAGAAAGAAATGGGGCTGGG - Intergenic
1120633120 14:86915746-86915768 GGAAATCCTGAGATTGGGCTTGG - Intronic
1120733077 14:88024466-88024488 GCAAACACAGGGTTGGGGCTAGG - Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121249225 14:92487393-92487415 GAAAGTATAGGGATGGGGATGGG + Intronic
1122541693 14:102501379-102501401 CAAAATACAGAAATGCTGCTGGG + Exonic
1202846072 14_GL000009v2_random:177611-177633 GAAAAGACAGACATGGGGTTAGG - Intergenic
1202915535 14_GL000194v1_random:168217-168239 GAAAAGACAGACATGTGGTTAGG - Intergenic
1202877211 14_KI270722v1_random:14822-14844 GAAAAGACAGACATGTGGTTAGG + Intergenic
1123437710 15:20267667-20267689 ATAAAAATAGAGATGGGGCTGGG + Intergenic
1123999556 15:25743488-25743510 AAAAATCCAGAGTTGAGGCTGGG + Intronic
1124799556 15:32817700-32817722 GGAAATAAAGAAATGAGGCTTGG + Intronic
1125813473 15:42563119-42563141 AAAAAAAAAGAAATGGGGCTGGG + Intronic
1125964493 15:43862801-43862823 AAAAATACAGAAATTAGGCTGGG - Intronic
1126815603 15:52450369-52450391 AAAAAATTAGAGATGGGGCTGGG + Intronic
1126957487 15:53950159-53950181 TAAAATGCAAAGAGGGGGCTTGG + Intergenic
1127236285 15:57056299-57056321 GAAAATACAGAAAAGTAGCTGGG - Intronic
1128047499 15:64631837-64631859 GAAAATATAGAGTTGTGGCCGGG - Intronic
1128089252 15:64907883-64907905 TAAAATACAAAGAAGGGGCTGGG - Intronic
1128097887 15:64972208-64972230 GATAAGAAAGTGATGGGGCTGGG - Intronic
1128330502 15:66752488-66752510 AAAAATACATACATAGGGCTGGG + Intronic
1128562347 15:68677231-68677253 GCAAATATAGTGATGGGGCTTGG - Intronic
1128990472 15:72255551-72255573 GAAAAATCAGAGAGTGGGCTGGG - Intronic
1129644116 15:77414507-77414529 GAAAATACAGTAATTGGGCCTGG - Intronic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1131109197 15:89754113-89754135 TAAAATACAGTAATGAGGCTGGG + Intergenic
1131159366 15:90094608-90094630 GAAAACACTGGGTTGGGGCTGGG + Intronic
1131942278 15:97580284-97580306 GAAAATATACAAATGGGGCTGGG - Intergenic
1132135985 15:99339433-99339455 AAAAAAACAGTGATTGGGCTGGG + Intronic
1133104163 16:3495808-3495830 GAAAATGCTGAAAAGGGGCTGGG + Intergenic
1133122599 16:3619520-3619542 AAAAATACAAAAATGGAGCTAGG - Intronic
1133189495 16:4123023-4123045 GAAATAAGAGAGATGGGGCCAGG + Intergenic
1133198824 16:4189934-4189956 GACAGTACAGAGATGAGGCGAGG + Exonic
1133202202 16:4210776-4210798 AAAAATAGAGATATGAGGCTGGG - Intronic
1133266939 16:4590721-4590743 AAAAATACAAAGATTAGGCTGGG + Intronic
1133283183 16:4678587-4678609 GGAGAGACAGAGATGGGGATGGG + Intronic
1133289118 16:4706530-4706552 GAAAATACAAAATTGTGGCTGGG - Intronic
1133939806 16:10299333-10299355 GAAAATACAGCCATTGTGCTGGG - Intergenic
1134087641 16:11369224-11369246 TAAAATATAGAGATGGGGCCGGG - Intronic
1134494433 16:14721247-14721269 AAAAATACAAAAATTGGGCTGGG - Intronic
1134499814 16:14760367-14760389 AAAAATACAAAAATTGGGCTGGG - Intronic
1134526361 16:14946986-14947008 AAAAATACAAAAATTGGGCTGGG - Intronic
1134546046 16:15109361-15109383 AAAAATACAAAAATTGGGCTGGG + Intronic
1134580763 16:15368683-15368705 AAAAATACAAAAATTGGGCTGGG + Intronic
1134713938 16:16345459-16345481 AAAAATACAAAAATTGGGCTGGG - Intergenic
1134721811 16:16388822-16388844 AAAAATACAAAAATTGGGCTGGG - Intronic
1134827497 16:17296323-17296345 AAGATTGCAGAGATGGGGCTGGG + Intronic
1134945614 16:18323047-18323069 AAAAATACAAAAATTGGGCTGGG + Intronic
1134952879 16:18363199-18363221 AAAAATACAAAAATTGGGCTGGG + Intergenic
1135573783 16:23569256-23569278 TAAAATACAGAAAAGAGGCTGGG + Intronic
1135724102 16:24841199-24841221 AAGAACCCAGAGATGGGGCTGGG - Intergenic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1136571232 16:31098221-31098243 GAAAATACAAAAATTGGGCCAGG - Intergenic
1136656167 16:31710624-31710646 AAAAAAACAGAGCTAGGGCTGGG + Intergenic
1136846865 16:33583188-33583210 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1137431752 16:48423804-48423826 AAAAATACAAAGATTAGGCTGGG - Intronic
1137720863 16:50626586-50626608 GAAGAGACACAGATGTGGCTGGG + Intronic
1137768911 16:50999290-50999312 GAAAATTCAGATAAGGGGATTGG + Intergenic
1137944452 16:52720358-52720380 CAAAATACACACATGAGGCTGGG - Intergenic
1137964264 16:52915189-52915211 GGAAAGACAGAGTTGAGGCTGGG - Intergenic
1138120387 16:54396570-54396592 AAAAATACATATATGGGGCCGGG - Intergenic
1139477980 16:67212478-67212500 AAAAATACAGAAATTAGGCTGGG + Intronic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1139856077 16:69981328-69981350 AAAAATACAAAAATTGGGCTGGG + Intergenic
1140307021 16:73812511-73812533 CATAATAAAGAGATGGGGCAGGG + Intergenic
1141077949 16:81025560-81025582 AAAAATACATAGGTGAGGCTAGG + Intronic
1141164694 16:81652626-81652648 GGGAAGACAGAGATGGGGATGGG - Intronic
1141806078 16:86342393-86342415 GAAACTGCAGAGGTGGGGCCCGG + Intergenic
1141878607 16:86842987-86843009 GGAAAGGCAGAGATGGGGCAGGG + Intergenic
1142434177 16:90046759-90046781 GAAAATACAGGGATGAGGAGAGG - Intergenic
1203108573 16_KI270728v1_random:1431843-1431865 ATAAAAATAGAGATGGGGCTGGG - Intergenic
1143185303 17:5006629-5006651 GAAAATTCTTAGGTGGGGCTAGG - Intronic
1143363830 17:6392575-6392597 CAAAATCAAGAGACGGGGCTGGG + Intergenic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1143575272 17:7788867-7788889 AAAAATATGTAGATGGGGCTGGG + Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1144075587 17:11716622-11716644 GAAAATAAATACATGGGACTGGG - Intronic
1144167929 17:12630582-12630604 GAAAAGACAGATTTGGTGCTGGG - Intergenic
1144870669 17:18368438-18368460 TAAAAGAGAGAGATTGGGCTGGG - Intergenic
1145000039 17:19298167-19298189 AAAAATACATAAATGAGGCTGGG - Intronic
1145165252 17:20609085-20609107 GAAAAAAAAAAGATTGGGCTGGG - Intergenic
1145811703 17:27768210-27768232 GAAAATACAGAAAATTGGCTGGG - Intronic
1145897067 17:28465292-28465314 GAAAATGCTTAGCTGGGGCTTGG + Intronic
1145955476 17:28851580-28851602 AAAAATACAGAAATTAGGCTAGG + Intronic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1146573755 17:33974419-33974441 AAAAATCCAGGGATAGGGCTGGG - Intronic
1147025641 17:37580826-37580848 AAAAATACAAAAATTGGGCTGGG - Intronic
1147059395 17:37862658-37862680 AAAAATACTGAGATAGGGCCAGG + Intergenic
1147192223 17:38744649-38744671 TAAAATGGAGAGATGGGTCTGGG - Intronic
1147682122 17:42256374-42256396 GAAAGAAAAGAGAGGGGGCTGGG - Intronic
1148370718 17:47097992-47098014 TAAAACACAGAGAAGGGGCCAGG - Intergenic
1148408672 17:47445160-47445182 AAAAATACTGAGATAGGGCCAGG + Intergenic
1149332060 17:55593968-55593990 GAAAGTACAAAAATGGGGCCGGG - Intergenic
1150342090 17:64376597-64376619 GTAAAGACAGAGATGGTGTTTGG - Intronic
1151023436 17:70647259-70647281 GAACAGACACAGATGGGGATTGG - Intergenic
1151050959 17:70978402-70978424 GAAAAAAGAGGGATGGGGATGGG + Intergenic
1152185950 17:78856420-78856442 GAACATGCGGAGAAGGGGCTGGG + Intronic
1152584998 17:81185046-81185068 GAAAATAAAAAGAAGGGGCCGGG + Intergenic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1153705089 18:7737097-7737119 AAAATTCCAGAGTTGGGGCTGGG - Intronic
1153848737 18:9072991-9073013 GAAAATACAAAAATTAGGCTGGG + Intergenic
1154093524 18:11387739-11387761 GAAATTTCAGAGATGAGCCTGGG - Intergenic
1154129244 18:11722714-11722736 GAAAATACAAAAATTGGGCAGGG + Intronic
1155178800 18:23325147-23325169 TGAAATCCAGAGATGGGGATGGG - Intronic
1155432294 18:25772274-25772296 GAAAATAAGAAAATGGGGCTGGG + Intergenic
1156869988 18:41934169-41934191 GACAGGAGAGAGATGGGGCTGGG + Intergenic
1157442657 18:47722430-47722452 GAAGAGACAGTGATGGGGTTTGG - Intergenic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1159226042 18:65537122-65537144 TAAAAAAAAGAAATGGGGCTTGG + Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159815932 18:73073596-73073618 AAAAATAAAGATATGTGGCTGGG - Intergenic
1160029200 18:75243919-75243941 GAAAAAATAGAGCTGGGGCCAGG + Intronic
1160580216 18:79879383-79879405 GAAAGGATAGACATGGGGCTTGG + Intronic
1160983274 19:1826462-1826484 GAAGAGACAGAGATGGGGGAAGG + Intronic
1161266635 19:3367317-3367339 GAAAATACCGGGACGGTGCTGGG - Intronic
1161960143 19:7518767-7518789 AAAAATAAAGAAGTGGGGCTGGG + Intronic
1162443072 19:10705208-10705230 GAAAAAATAAATATGGGGCTGGG - Intronic
1162724097 19:12679612-12679634 CAGAACACAGAGGTGGGGCTGGG - Exonic
1163646604 19:18493198-18493220 GATAATAAAGGAATGGGGCTGGG + Intronic
1164208746 19:23079099-23079121 AAAAATACATAGATAGGGCCGGG - Intronic
1164426578 19:28147086-28147108 GAAAATACAGAGAGATGGCTGGG - Intergenic
1164862115 19:31570046-31570068 GAAAAGTCAGACATGGGGCCAGG + Intergenic
1164867773 19:31619176-31619198 GAAAATACAAACATTGGGCTGGG + Intergenic
1165395557 19:35561834-35561856 AAAAAAAAAGAGATGGGACTTGG - Intronic
1165440228 19:35821991-35822013 TAAAATACTGAGAAGGGGCCAGG - Intergenic
1165814473 19:38633185-38633207 GAAAGTAGAGAGCTGGGGGTTGG + Intronic
1165962269 19:39545002-39545024 GAAAATACAAAGGTAGTGCTTGG + Intergenic
1165986927 19:39777662-39777684 TAAAAGACATAGATGGGGCCAGG + Intronic
1166044269 19:40220490-40220512 AAAAACACAGAGATCTGGCTGGG + Intergenic
1166362436 19:42259143-42259165 GAAAAATCAGAGATGTGGCCAGG + Intergenic
1166769245 19:45271063-45271085 AAAAATACAAAAATTGGGCTGGG - Intronic
1167589802 19:50398269-50398291 GAAAATAAAGAGATGTGCCAAGG + Intronic
1167792885 19:51691879-51691901 GGGAGGACAGAGATGGGGCTGGG + Intergenic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168382545 19:55936318-55936340 GAAAATCCAGAAATAGGGCTGGG + Intergenic
1168418527 19:56185003-56185025 GAAAGTAGAGAGAAGGGGCCAGG + Intronic
1202673468 1_KI270710v1_random:18109-18131 GAAAAGACAGACATGTGGTTAGG - Intergenic
925324517 2:3007519-3007541 GAGAATGGAGAGATGGCGCTGGG + Intergenic
926662348 2:15481547-15481569 GCAAATACAGAGAAGTGGCATGG - Intronic
926662357 2:15481646-15481668 GCAAATACAGAGAAGTGGCATGG - Intronic
926900895 2:17751182-17751204 GAAAACACTGAGTTTGGGCTGGG + Intronic
928151059 2:28829646-28829668 GAAAATACAAAAATTAGGCTGGG + Intronic
928890666 2:36199658-36199680 GAAAATATAGATTTGGGGCCAGG - Intergenic
929923891 2:46193608-46193630 GGAAATCCAGAGAAGGGGGTAGG + Intergenic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930211672 2:48645560-48645582 CAAAATCAAGAGATGGTGCTCGG - Intronic
930368885 2:50479237-50479259 GAAAATGCAGAGTTGGGGAAAGG - Intronic
930848399 2:55931322-55931344 GTAAATAAAGAGATAGGGCAGGG - Intergenic
930850002 2:55950531-55950553 GAAAGTCCAGGGAAGGGGCTCGG + Intergenic
931037648 2:58261078-58261100 GAAAATACAGAGTTCTGGATTGG + Intergenic
931518053 2:63063501-63063523 GAAAATAGAAAGATGAGACTTGG - Intergenic
931669359 2:64632971-64632993 GAGAAAACCGAGCTGGGGCTGGG - Exonic
933047204 2:77554098-77554120 GAAAAGGGAGAGATGGGGCAAGG - Intronic
933406767 2:81870265-81870287 GTAAATACATAGGTGGGGCTTGG - Intergenic
933887748 2:86735700-86735722 AAAAATACAAAAATGTGGCTGGG - Intronic
933922429 2:87061012-87061034 AAAAATACAAAAATGTGGCTGGG + Intergenic
934071271 2:88385991-88386013 GAAAATATACAAATGGGGCAGGG + Intergenic
934102956 2:88670517-88670539 CAAGATACAGAACTGGGGCTGGG + Intergenic
934555127 2:95283037-95283059 CAAGGTACAGAGTTGGGGCTGGG - Intronic
934781792 2:96974085-96974107 AAATATACAGAAAAGGGGCTGGG + Intronic
936548026 2:113409526-113409548 GATGATGCAGAGTTGGGGCTGGG - Intergenic
936710686 2:115127438-115127460 GCAAAGACAGAGGTGGGGTTGGG - Intronic
937075645 2:119104335-119104357 GCAAATATAAAGCTGGGGCTGGG - Intergenic
937165306 2:119808711-119808733 TAAAAGACAGTGATTGGGCTGGG - Intronic
937242396 2:120470718-120470740 GAAAATGAAGAGGTTGGGCTAGG - Intergenic
937328280 2:121005316-121005338 GTAGGTAAAGAGATGGGGCTGGG - Intergenic
937345179 2:121121053-121121075 GCAAAGTCAGAGATGGGGCCCGG - Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
939132991 2:138259927-138259949 GAATATGCTGAGATGGGACTGGG + Intergenic
939320919 2:140621084-140621106 GAAAATACTGATATTGGGCCAGG + Intronic
939685096 2:145189279-145189301 GAAAATGCCTAGATAGGGCTGGG + Intergenic
940667509 2:156626570-156626592 GAAAACTGAGAGATGGGGCAAGG - Intergenic
941702535 2:168619337-168619359 GAAAAAACAGAGAAATGGCTGGG + Intronic
941941683 2:171045503-171045525 GAAAATACATAGACCGGGCACGG - Intronic
943324201 2:186478504-186478526 GAAAATACAAATATGGGTTTGGG - Intergenic
943417537 2:187627687-187627709 GAACAAAAAGAGATGGGACTTGG + Intergenic
944075380 2:195723754-195723776 AAAAATACAGCCATGGGGCAAGG + Intronic
944654397 2:201863554-201863576 TAAAACACAGAGCTGGGGCTGGG + Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
945151105 2:206792927-206792949 GAAAATACAAAAACTGGGCTGGG + Intergenic
945932452 2:215868706-215868728 GAGAATAAAGAGATGCGTCTTGG - Intergenic
945984156 2:216340752-216340774 GAAAATACAGTGTTGGGGTAGGG + Intronic
946019528 2:216631949-216631971 AAAAACACAGAAATGGGGCCGGG - Intergenic
946033634 2:216724652-216724674 GAATAAATAAAGATGGGGCTGGG - Intergenic
946201173 2:218071629-218071651 GAAAATGCTGAGATGGGGGATGG - Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
947025088 2:225728817-225728839 TAAAATACAAAGATAGGCCTTGG + Intergenic
947123806 2:226845549-226845571 GAAAGTAAAGAGATGGGCTTTGG - Intronic
947533895 2:230928995-230929017 TAAAATAAAGAAGTGGGGCTTGG - Intronic
947850598 2:233284625-233284647 AAAAATACAAAAATTGGGCTAGG - Intronic
948127475 2:235575163-235575185 GAGAATAAAGAGATGGTGGTTGG + Intronic
948507881 2:238442405-238442427 AAAATTAGAGAGATGGGGCGGGG - Intronic
1168753904 20:302520-302542 GTTAATCGAGAGATGGGGCTGGG + Intergenic
1169120804 20:3094516-3094538 GAAAAAAAAAAGATTGGGCTTGG + Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169442436 20:5643865-5643887 GAAAGAGCAGAGATGTGGCTGGG - Intergenic
1169592054 20:7155355-7155377 GTAGATAGAGAGATGGGGCCTGG + Intergenic
1169626524 20:7577402-7577424 GCAAGGTCAGAGATGGGGCTTGG + Intergenic
1170136342 20:13077939-13077961 AAAAATACAGATGTTGGGCTTGG - Intronic
1170989416 20:21288196-21288218 AAAAATAGAAAAATGGGGCTGGG + Intergenic
1171002719 20:21430827-21430849 GAAAATAGAGAGCTTGGGCATGG + Intergenic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171165027 20:22962241-22962263 GAAAAATCAGAAATGAGGCTGGG - Intergenic
1171974015 20:31582415-31582437 AAAAATACAAAAATTGGGCTGGG + Intergenic
1172055640 20:32152521-32152543 GAAGATGCAGAGATGGGGGTGGG - Intronic
1172065040 20:32213475-32213497 AAAAATATAAAGATGAGGCTGGG + Intronic
1172254596 20:33506110-33506132 GAAAAGAAATAGAAGGGGCTGGG + Intronic
1172336915 20:34124226-34124248 GAAAATTCATAGATATGGCTGGG - Intergenic
1172553734 20:35822536-35822558 GAAAGTACAGAGTTCTGGCTGGG + Intronic
1172607749 20:36225955-36225977 GAAGAGAGAGAGATGGGGCATGG - Intronic
1173233590 20:41222560-41222582 GAAACTACAGAAATGGGGGTTGG + Intronic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174657162 20:52181235-52181257 AAATAAACAGAGAGGGGGCTGGG - Intronic
1175495236 20:59409906-59409928 GAATAGACAGAGATGGGGTAAGG + Intergenic
1175512616 20:59542560-59542582 GAAAATACACAGTCAGGGCTGGG - Intergenic
1175837341 20:62004620-62004642 GAAAATTCAGAAAGGGAGCTGGG - Intronic
1176634887 21:9182865-9182887 GAAAAGACAGACATGTGGTTAGG - Intergenic
1176638486 21:9272268-9272290 GAAAATACAGACATGTGGTTAGG + Intergenic
1176992099 21:15509260-15509282 GATAAAACAGAAATGGAGCTAGG + Intergenic
1177306918 21:19330693-19330715 GAAAAGACAGAAATGGTGGTGGG - Intergenic
1178088799 21:29139878-29139900 AAAAAGCCAGAGATGGGGCCTGG - Intronic
1178290060 21:31359497-31359519 GAAAATACAGTGAAAGGGCCGGG + Intronic
1179813468 21:43887143-43887165 GCAAAAACAGAGAAGGAGCTGGG - Intronic
1179988880 21:44935539-44935561 CAGAATGCAGAGAGGGGGCTAGG - Intronic
1180245367 21:46543742-46543764 GCACATGCAGAGATGGGGCAAGG - Intronic
1180370486 22:12031143-12031165 GAAAATACAGACATGTGGTTAGG - Intergenic
1180415254 22:12703935-12703957 GAAAAGACAGACATGTGGTTAGG + Intergenic
1180422527 22:12879765-12879787 GAAAATACAGACATGTGGTTAGG + Intergenic
1180457702 22:15525444-15525466 AAAAATGCAAGGATGGGGCTGGG + Intergenic
1180589395 22:16923600-16923622 GATGATGCAGAGTTGGGGCTGGG + Intergenic
1180923668 22:19537135-19537157 AAAAGTACATAGTTGGGGCTGGG - Intergenic
1181012012 22:20046795-20046817 AAAAATACAAAAATTGGGCTGGG - Intronic
1181756146 22:25026433-25026455 AAAAAGACAGAGCTGAGGCTGGG + Intronic
1182340311 22:29614886-29614908 AAAAATACAGAAATTAGGCTGGG + Intronic
1182502857 22:30760518-30760540 GAAAATCAATAAATGGGGCTGGG + Intronic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1183093071 22:35536618-35536640 GTAGACAAAGAGATGGGGCTGGG - Intergenic
1183172169 22:36196615-36196637 GGAACTCCAGAGAAGGGGCTGGG + Intronic
1183245826 22:36692661-36692683 ACAAATAAAGAGATGGGGCCTGG - Intronic
1183621226 22:38973927-38973949 AGAAACACAGGGATGGGGCTGGG + Intronic
1183648722 22:39141451-39141473 GAAAGGTCAGAGTTGGGGCTGGG + Intronic
1183766615 22:39882707-39882729 GAAAATACACAAAGAGGGCTGGG + Intronic
1183908536 22:41061366-41061388 GAAAATACTGAGCTCAGGCTGGG - Intergenic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
1183995077 22:41626933-41626955 GAAAATACAAACATTAGGCTGGG - Intronic
1184025137 22:41850152-41850174 GAAAGTAATGAGATGGGGCTGGG + Intronic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
949439635 3:4066680-4066702 GAAAGAACAGAGTTGAGGCTTGG + Intronic
949976204 3:9462610-9462632 GAATATAGATAGATGGGGCCAGG + Intronic
949994576 3:9606466-9606488 TTAAATATAGAGATGGGGCCAGG + Intergenic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950896453 3:16455976-16455998 GATAATGCAGAGACGGGGGTGGG - Intronic
951170534 3:19536851-19536873 GTAAATACAGAGAAGGGGACTGG - Intergenic
951556433 3:23925341-23925363 GAACATACTGAGACTGGGCTTGG + Intronic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
953085844 3:39666152-39666174 GAAAATTCATAAATGGGGATTGG + Intergenic
953179575 3:40583280-40583302 AAAATCACAGAGGTGGGGCTGGG + Intergenic
953362873 3:42314465-42314487 AAAAATACAATGATAGGGCTGGG - Intergenic
953461984 3:43088815-43088837 GGATGTCCAGAGATGGGGCTTGG - Intronic
953607412 3:44420776-44420798 GAAAGCACAGAGCTGGGGATGGG + Intergenic
953889100 3:46737229-46737251 GAAAATACAGACCTTGGGCTGGG - Intronic
953889220 3:46738242-46738264 GAAAGTAAAAAGATGTGGCTGGG + Intronic
954198458 3:49010015-49010037 AAAAAAATAGAGATGGGGCCTGG - Intronic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
954844758 3:53545780-53545802 GATAAAACAGAGTTGGGGCAGGG + Intronic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
955931537 3:64062366-64062388 GATAATACAGAAATGAAGCTGGG + Intergenic
956090556 3:65662040-65662062 AGAAATACAAAGATGAGGCTGGG - Intronic
956138431 3:66121380-66121402 GCAGATGCAGAGACGGGGCTGGG + Intergenic
956657823 3:71568940-71568962 GAAAATTCAGAGAACAGGCTGGG - Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
956769208 3:72510237-72510259 GAAAATAAAGAGGAGAGGCTGGG + Intergenic
956804502 3:72795807-72795829 GAAAATGCAGGATTGGGGCTAGG + Intronic
956851565 3:73232662-73232684 GAAATTATAGACATGAGGCTGGG - Intergenic
957102378 3:75844834-75844856 GAAAAGACAGACATGTGGTTAGG - Intergenic
958445857 3:94214070-94214092 GGAAGTACAAAGATGGGCCTAGG + Intergenic
958491265 3:94776871-94776893 GGAGATACAGGGATGGGGATGGG - Intergenic
958623750 3:96598415-96598437 GAAAATGGAGAGGTAGGGCTTGG - Intergenic
959035689 3:101360906-101360928 GAAAATATAGAGAACTGGCTGGG + Intronic
959116593 3:102185546-102185568 GAGAATTCAGATATGTGGCTTGG - Intronic
959356212 3:105332426-105332448 GAAAATATAGAGAAAGAGCTTGG + Intergenic
959659432 3:108849604-108849626 CAAAATACAGAGCTGGGGTAGGG + Intronic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960510230 3:118540691-118540713 GCAAGCACAGAGTTGGGGCTAGG + Intergenic
960976853 3:123184202-123184224 GAAAATACAAAAATTCGGCTGGG + Intronic
961034262 3:123631407-123631429 AAAAAAAGAGAGATGGGTCTGGG + Intronic
961093020 3:124131820-124131842 GAAAAGCCAGAAATGGGCCTGGG - Intronic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
961600606 3:128058564-128058586 TAAAATACACACATGTGGCTGGG + Intronic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
961615618 3:128177405-128177427 TAAAATCCAGAGATGCGGGTGGG - Intronic
961889919 3:130122196-130122218 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
962309814 3:134317456-134317478 GAGGACCCAGAGATGGGGCTAGG - Intergenic
962566702 3:136667789-136667811 AAAAACACAGAAATGGGGCCAGG - Intronic
962793566 3:138832530-138832552 AAAAATACAAAGATTGGGCCGGG + Intronic
963765207 3:149327477-149327499 AAAAATCCAGAGCTGGGGCTTGG + Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
964011036 3:151892096-151892118 GAAAAAACAGAGATGTGCCCAGG + Intergenic
964105121 3:153030962-153030984 AAAAATACAAAAATTGGGCTGGG + Intergenic
965659169 3:171022590-171022612 GAAAATGCAGGGATGAGACTGGG - Intronic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
965888705 3:173482438-173482460 GAAAGTGTGGAGATGGGGCTGGG - Intronic
965899481 3:173620743-173620765 GATAACACAGAAGTGGGGCTGGG + Intronic
966524911 3:180910324-180910346 AAAAATACAAAGATTAGGCTAGG + Intronic
966795570 3:183710138-183710160 GAAAATACTGAGATGGTACTAGG - Intronic
967015660 3:185479352-185479374 GAAAAGGCAGAGCTGAGGCTTGG - Intronic
968004808 3:195235215-195235237 GAAAATACACAGTTAGAGCTGGG - Intronic
1202748409 3_GL000221v1_random:132753-132775 GAAAATACAGACATGTGGTTAGG - Intergenic
968637791 4:1690982-1691004 GATAATTCAGAGATGGAGCCAGG - Intergenic
968772619 4:2517339-2517361 AAAAAAATAGAGTTGGGGCTGGG - Intronic
968837876 4:2978932-2978954 GAAAATACACAAATTAGGCTGGG + Intronic
969086578 4:4661124-4661146 AAAAATACAAAAATTGGGCTGGG - Intergenic
969165742 4:5309868-5309890 AAAAATAGAAAAATGGGGCTGGG + Intronic
969279239 4:6158489-6158511 TAAAATAAAGGGCTGGGGCTTGG + Intronic
969753621 4:9132493-9132515 GAAAATGCAGGGAAGGTGCTTGG + Intergenic
969813517 4:9668676-9668698 GAAAATGCAGGGAAGGTGCTTGG + Intergenic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970327685 4:14944477-14944499 GAAAATACAGAGACAGAGATTGG + Intergenic
970422519 4:15918794-15918816 GAAGAGACAGAGCTGTGGCTGGG - Intergenic
971417659 4:26447857-26447879 CAGAAAACAGAGATAGGGCTGGG - Intergenic
972037113 4:34539027-34539049 GACAATACAGGGATAGAGCTAGG - Intergenic
972058114 4:34829452-34829474 GAAAATACAGATACAGGCCTTGG + Intergenic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
972694366 4:41430558-41430580 TAAAATACAGAGATGGGGGCAGG - Intronic
973697185 4:53501576-53501598 GAAAAGACAGAGATGGGTCTGGG - Intronic
973909690 4:55566722-55566744 GAAAATACATTCCTGGGGCTGGG - Intronic
974250235 4:59375895-59375917 GAACATGCAGAAATGGGCCTTGG - Intergenic
974715625 4:65667485-65667507 GACTACACGGAGATGGGGCTTGG - Intronic
975564531 4:75739836-75739858 AACAATACAAAGATGAGGCTGGG - Intronic
976143176 4:82014483-82014505 GAGAAGACAGAGCTGAGGCTGGG + Intronic
976180906 4:82397939-82397961 AAAAATACAGAAATTAGGCTGGG + Intergenic
976266329 4:83188899-83188921 GGAAGTACAGAGATGGGCCTTGG + Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
976449291 4:85168138-85168160 AGAAAAACAGATATGGGGCTGGG - Intergenic
977437573 4:97018851-97018873 AAAAATAAATGGATGGGGCTGGG - Intergenic
978382272 4:108141858-108141880 GAACATGCAAAGATGGGGGTGGG + Intronic
978464083 4:108988899-108988921 GAAAAGACAGAAATGAGGGTAGG - Intronic
978484698 4:109238757-109238779 GGATATACAGAGAATGGGCTAGG - Intronic
981234957 4:142405094-142405116 TCAAATCCAGAGATGGGGCGGGG + Intronic
981508516 4:145529382-145529404 GAAAAGACAGAGAGGGAACTAGG + Intronic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
982117744 4:152112238-152112260 GTAAATCCAGAGCTGGGGGTGGG - Intergenic
982720249 4:158852222-158852244 GAAAATACAGTGATGGTCATGGG + Intronic
982909545 4:161121869-161121891 GAAAATACTTAGATCAGGCTGGG - Intergenic
984262783 4:177461947-177461969 GAAAATCCAGAGCTGGGGCTGGG + Intergenic
984565562 4:181326043-181326065 GTATATACAGAAATAGGGCTGGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
1202753373 4_GL000008v2_random:30682-30704 GAAAATACAGACATGTGGTTAGG + Intergenic
986450293 5:7856702-7856724 GCAAATCCAGAGAGGGGTCTTGG - Intronic
986925762 5:12747679-12747701 GGAAATACAGAAATTGGCCTGGG - Intergenic
986956429 5:13156280-13156302 GAAATTACAGAGATAAGGCCAGG + Intergenic
987249023 5:16079942-16079964 GAAAATCCAGAGATGGGAAGGGG - Intronic
987768029 5:22261331-22261353 GAAAATAGAGAAATGGTGATGGG - Intronic
987910060 5:24130969-24130991 CATAATAAAGGGATGGGGCTTGG - Intronic
988770198 5:34425823-34425845 GAAAAAACAGAGAGAGGGCCGGG + Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
988807454 5:34753618-34753640 GAAAATACAAAAATTGGGCCAGG + Intronic
988810659 5:34781992-34782014 GGAAATAAAGGGATGGGTCTGGG + Intronic
990362890 5:55039118-55039140 AAATATACATGGATGGGGCTGGG - Intergenic
990467551 5:56084167-56084189 AAAAATAGGGAGATGAGGCTGGG - Intergenic
990589861 5:57250838-57250860 GAAAATACATAAATGCGGCCAGG - Intronic
990981768 5:61607746-61607768 GTACATACAGAGATGGTGGTAGG - Intergenic
991179964 5:63738678-63738700 GAAAATACAGTATTGGGGCCAGG - Intergenic
991181808 5:63760727-63760749 GAAAATAAATTGATGGGGCCAGG - Intergenic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
991412894 5:66362465-66362487 GAAAGAACAGAGATGGGGATGGG - Intergenic
992549969 5:77850917-77850939 ATAAATACTGAGCTGGGGCTGGG - Intronic
992855003 5:80850550-80850572 GCAAAGACAGAGATTGTGCTGGG + Intronic
993397754 5:87412261-87412283 GAAGTTACAGAGATGGTGCGTGG - Intronic
995119060 5:108516612-108516634 GAAAGAAAAGAGATGGGGATGGG - Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
995385450 5:111583856-111583878 TAAAATAAGGTGATGGGGCTGGG + Intergenic
995409277 5:111836341-111836363 GAATATACAGAGAGGGGTGTGGG + Intronic
995605119 5:113845847-113845869 GAAAATACAGACATTTGTCTTGG + Intergenic
996474030 5:123894927-123894949 GAAAATCCAGACATTGGGCTGGG + Intergenic
996754650 5:126922839-126922861 TAAAAGACAGAAATGAGGCTGGG - Intronic
996943444 5:129037914-129037936 GAAAATGGAGAGTTAGGGCTAGG + Intergenic
997274990 5:132578106-132578128 AAAAAATCAGAGATGGGGCTGGG - Intronic
997804693 5:136905558-136905580 GATTATACAGAGATGTGGGTAGG + Intergenic
998235806 5:140397737-140397759 AAAAATACAAAAATTGGGCTGGG - Intergenic
998236067 5:140400134-140400156 AAAAATACAAAAATTGGGCTCGG - Intergenic
998348002 5:141481520-141481542 AAAAATCTAGAGATGGGGCTGGG + Intronic
998363340 5:141610592-141610614 AAAAATACAAAAATTGGGCTGGG - Intronic
998490206 5:142540019-142540041 CAAAATAAAAAGATGGGGGTTGG + Intergenic
998547783 5:143045836-143045858 GAAAATACAAAAATTAGGCTGGG + Intronic
998570694 5:143254005-143254027 GAAAGGACAGAGCTGGCGCTGGG + Intergenic
998573767 5:143290855-143290877 TTAAATATAGAGATGGGGCCAGG - Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998628852 5:143876225-143876247 GAGAATGAAGAGAAGGGGCTTGG + Intergenic
999315580 5:150581938-150581960 GAAAAGAAAGAGCTTGGGCTTGG + Intergenic
999662826 5:153883383-153883405 GAAGAGAGAGAGATGGGGATTGG - Intergenic
999969827 5:156848275-156848297 GAAAATACAGAGTTAGGGCCAGG + Intergenic
1000006871 5:157193733-157193755 GAAAAGGCAGAGTTGGGGCAAGG + Intronic
1000041756 5:157489688-157489710 AAAAAGACAAAGAGGGGGCTGGG + Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1001197906 5:169690311-169690333 GAAATTACAGAGAAGGAGCCAGG + Intronic
1001224975 5:169936278-169936300 TCAACGACAGAGATGGGGCTAGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001376797 5:171267337-171267359 GAAAACACAGTGATAGGGCTAGG - Intronic
1001496692 5:172192893-172192915 AAAAATACAAAAATTGGGCTGGG + Intergenic
1001544347 5:172561179-172561201 GCAAATATAAAGAAGGGGCTGGG - Intergenic
1001976135 5:176000710-176000732 TAAAAAACAGAGATTGGGCTGGG + Intronic
1002060977 5:176625899-176625921 GAAAAGACAGAGAGGGCGATGGG - Intronic
1002241288 5:177843063-177843085 TAAAAAACAGAGATTGGGCTGGG - Intergenic
1002653069 5:180718075-180718097 CACAAAACAGAGATGGGGCAGGG + Intergenic
1002891877 6:1340410-1340432 GAAAATACGCAGCTGAGGCTAGG - Intergenic
1003653471 6:7984239-7984261 GAAAATACATAAAAGAGGCTGGG - Intronic
1004221575 6:13751993-13752015 GAAATTGGAGAGAGGGGGCTGGG - Intergenic
1004643300 6:17536116-17536138 GAAAAAACAGAGAGAAGGCTGGG - Intronic
1004829029 6:19457485-19457507 GTAAATACAGAGATGGCTTTTGG - Intergenic
1004924000 6:20402092-20402114 GAAAAGAGAGAGAGGGGGCTCGG + Intronic
1005976452 6:30803771-30803793 GAAAATACAGAAATTTGGCTGGG + Intergenic
1006255954 6:32832471-32832493 GAGAAGAAAGAGATGAGGCTGGG + Intronic
1006342382 6:33453610-33453632 GAAAAAAAGGAAATGGGGCTGGG - Exonic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1007392699 6:41559515-41559537 GAAAAAAAAGAGAAGGGGCTAGG + Intronic
1007541822 6:42653376-42653398 TAAAATACAAACAAGGGGCTGGG - Intronic
1007586434 6:42992999-42993021 AAAAATACAAAAATTGGGCTGGG + Intronic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1009191620 6:60635911-60635933 GAAAATACAGAGTAGGGGGGTGG - Intergenic
1009351158 6:62680622-62680644 AAAAATATTGAGATGGGGCCGGG + Intergenic
1010441388 6:75899084-75899106 GTAACTCCAGAGATGGGGGTGGG + Intronic
1010852761 6:80798335-80798357 GAAAATGGAGAGGTGGGGCCAGG - Intergenic
1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG + Intergenic
1012849502 6:104429868-104429890 GAAAAGAGAGAGATGGGGCCAGG + Intergenic
1013197942 6:107862404-107862426 GATGATACAGAGCTGGGGCAGGG - Intergenic
1015382050 6:132580788-132580810 GAACACACAGAAATAGGGCTTGG + Intergenic
1015702345 6:136050338-136050360 GAAAATTCACAGAGAGGGCTTGG - Intronic
1016718596 6:147265642-147265664 GAAAATACTGAGGTGGGGCCTGG + Intronic
1016877692 6:148880248-148880270 GAAAAGTCAGAGATCTGGCTGGG - Intronic
1017159933 6:151355282-151355304 CAAAAAACAAAGATAGGGCTGGG - Intronic
1017159976 6:151355594-151355616 AAAAAAACAAAGATGGGGCCGGG - Intronic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1017806201 6:157947608-157947630 AAAAATGCAGAACTGGGGCTAGG + Intergenic
1018551077 6:164999533-164999555 GAGAAGACAGAGATGGCTCTGGG + Intergenic
1018846004 6:167556491-167556513 GAGAAGACAGAGATGGGAATTGG - Intergenic
1020035995 7:4963400-4963422 GAGAAGGCAGGGATGGGGCTTGG + Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1021245503 7:18256790-18256812 TAAAATACATAAATGTGGCTGGG + Intronic
1021263143 7:18484049-18484071 TAAAATACTGTTATGGGGCTGGG + Intronic
1021528271 7:21613564-21613586 GAAGAGACAGAGTTGGGGTTGGG + Intronic
1021783453 7:24129558-24129580 GAAAAGACAGAGATGTGGAGAGG - Intergenic
1022157578 7:27675712-27675734 GAAAAGTCACAGTTGGGGCTGGG - Intergenic
1022214997 7:28250406-28250428 AAAAATGAAGAGATGGGGGTCGG - Intergenic
1023087464 7:36585763-36585785 GAAAATACACAGAAAGGGCCTGG + Intronic
1023941840 7:44773360-44773382 TAAAATAAAGAGTTGGGGCCGGG - Intergenic
1026613298 7:71879973-71879995 GAAAAAACAGAGGTTAGGCTGGG + Intronic
1026936358 7:74258502-74258524 GAAAAACCATAAATGGGGCTGGG - Intergenic
1027047101 7:74998306-74998328 GCAAAGACAGAAATGGGGCCGGG + Intronic
1027415928 7:77975002-77975024 GAAAATACAAAAATTGGGCCGGG + Intergenic
1027608072 7:80325022-80325044 GAAAACACAGAAAAGGGGCTGGG + Intergenic
1027796953 7:82707602-82707624 GAAAATAGACTGATGGGCCTTGG + Intergenic
1028108946 7:86915602-86915624 GAAAATTCAGAGTTTAGGCTTGG - Intronic
1028704036 7:93816974-93816996 TAAAATACACAGATAGGTCTGGG + Intronic
1028766917 7:94570106-94570128 GAAAAGTCAGAGATTGGGCCAGG - Intergenic
1028914173 7:96240581-96240603 GAAAATACAGTGCCGGGGTTGGG + Intronic
1029342183 7:99954266-99954288 GAAAATACTAATATGGGGCTAGG - Intergenic
1029385894 7:100243334-100243356 GCAAAGACAGAAATGGGGCGGGG - Intronic
1029447472 7:100621885-100621907 AACAAACCAGAGATGGGGCTAGG - Intronic
1029632309 7:101760631-101760653 AAAAATGCGGATATGGGGCTGGG - Intergenic
1029691214 7:102183307-102183329 AAAAATTAAGAGATGGGGCCGGG - Intronic
1030969702 7:116040749-116040771 CAAATGGCAGAGATGGGGCTGGG - Intronic
1031463726 7:122082780-122082802 GAACTCACATAGATGGGGCTGGG + Intronic
1031463802 7:122083690-122083712 GAACTCACATAGATGGGGCTGGG + Intronic
1032169037 7:129568996-129569018 AAAAAAACAGAAAAGGGGCTGGG + Intergenic
1032820705 7:135521674-135521696 AAAAATACAAAAATTGGGCTGGG + Intergenic
1032911934 7:136442582-136442604 AAAAATTCAGAGGTGGGGCATGG + Intergenic
1033158083 7:138973115-138973137 AAAAATACAGTGACTGGGCTGGG - Intronic
1033598469 7:142872498-142872520 GAGAAGTCAGAGATGAGGCTGGG + Intronic
1033723507 7:144086710-144086732 GAAAACACAGAGATGCGGAAAGG - Intergenic
1034067996 7:148155195-148155217 GAAGAGACAGAGATGGGATTTGG + Intronic
1034232699 7:149544707-149544729 GAAAATAAAGAGTTGGGAATAGG - Intergenic
1034628195 7:152510314-152510336 TTAAAAATAGAGATGGGGCTGGG + Intergenic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1035608522 8:945538-945560 GAAGAGACAAAGATGGGGCAGGG - Intergenic
1036009549 8:4706710-4706732 CAAAAGACAGAGATGTGGCCGGG + Intronic
1036376834 8:8207825-8207847 GAAAATGCAGGGAAGGTGCTTGG + Intergenic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1036826778 8:11983096-11983118 TAAAAGACAGATATGAGGCTGGG + Intronic
1036852703 8:12215312-12215334 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1036874074 8:12457834-12457856 GAAAATGCAGGGAAGGTGCTTGG - Intergenic
1036947597 8:13109265-13109287 AAAAATACTGAGATGGGGTGTGG + Intronic
1037842448 8:22254909-22254931 GAAAAAACAGAGATGGTGATGGG + Intergenic
1038050842 8:23809513-23809535 GAGAGTACAGAGATGGTGCAAGG + Intergenic
1038288093 8:26224291-26224313 AAAAATCCAGAAAAGGGGCTGGG + Intergenic
1038696489 8:29811286-29811308 TAAAATAAAGAGATTGGACTAGG - Intergenic
1039003773 8:33011021-33011043 GTAAATTCAGAGATGGGGGTGGG - Intergenic
1039237248 8:35515387-35515409 CAAAATACAGATTTAGGGCTGGG + Intronic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1039905201 8:41781484-41781506 GAAAATACAGTGAGAGGGCCTGG - Intronic
1040511332 8:48098917-48098939 GAAAATACACAGAGAAGGCTGGG - Intergenic
1040601007 8:48883803-48883825 GAAAATACAGAGTTGGGGGTGGG + Intergenic
1040614302 8:49018985-49019007 TCAAAAACAGAGATGGGGCTGGG - Intergenic
1041210937 8:55550136-55550158 CAAAATACAGAGATAGGTCCTGG - Intergenic
1041513959 8:58679429-58679451 GTAAATAGAGAGATGAGGCATGG + Intergenic
1041870684 8:62631327-62631349 GAAATATCAGAGATGGGGCAGGG - Intronic
1042540463 8:69902689-69902711 AAAAATAAACAAATGGGGCTGGG - Intergenic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1042884264 8:73530667-73530689 GAAAATACAGAAATTGGGCTTGG + Intronic
1043439576 8:80265473-80265495 GAAAAGAAAAAGATGTGGCTGGG - Intergenic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1044836849 8:96303993-96304015 GAAAATCCAGAGATAAGGCAGGG - Intronic
1044985702 8:97754772-97754794 AAAAATACAGAAATTGGGCCAGG - Intergenic
1045123129 8:99060311-99060333 AAAAATACATAAATTGGGCTAGG + Intronic
1045344883 8:101284975-101284997 GAGATTTCAGAGATTGGGCTGGG - Intergenic
1045397486 8:101775460-101775482 GAATCTACAGAGGTGGGGCTTGG - Intronic
1045519717 8:102893308-102893330 GAAAATACAGAAGATGGGCTGGG + Intronic
1046155489 8:110284331-110284353 GAAATTATAAAGATGGGGCTGGG - Intergenic
1046522404 8:115342175-115342197 GAAGATAAAGATATGGGGCCGGG - Intergenic
1046658559 8:116923928-116923950 AAAAATACAAAAATTGGGCTGGG - Intergenic
1047010183 8:120663768-120663790 GAGAAGACAGAGACGGGGCAAGG + Intronic
1047756469 8:127922763-127922785 GGAAGTAAAGAGATGGGCCTGGG - Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1047962742 8:130022802-130022824 AAAAATCAAGAGAGGGGGCTGGG + Intergenic
1048198378 8:132351420-132351442 GAAATTAGAGAGTTGGGGCAGGG - Intronic
1048969315 8:139635623-139635645 GAAAATAAAGACAGGTGGCTGGG - Intronic
1049398281 8:142412052-142412074 GAAAACACAGAGAGAGGCCTGGG - Intergenic
1049641566 8:143718326-143718348 GACAGAACAGAGGTGGGGCTGGG - Intronic
1050582792 9:7078588-7078610 TAAAATACAGACCTTGGGCTTGG - Intergenic
1050628378 9:7532759-7532781 GAAAATACAAACAAGTGGCTGGG - Intergenic
1051084628 9:13334142-13334164 GAAAGTACAGTGATGAGGATGGG - Intergenic
1051361721 9:16286839-16286861 GATAATAAAGAAATTGGGCTTGG - Intergenic
1051418039 9:16863206-16863228 GAATATATTGAGATGGGGCAGGG - Intronic
1052465394 9:28822862-28822884 TAAAATCCAGAGATGGCACTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052932204 9:34064966-34064988 AGAAATACAGACATGAGGCTAGG - Intergenic
1053267151 9:36723810-36723832 GGAAATACAGAGGTGGGGGCTGG - Intergenic
1053425765 9:38008925-38008947 GGCACTACAGAGCTGGGGCTGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053545495 9:39018895-39018917 GGACATACATAGATGGGCCTAGG + Intergenic
1054878037 9:70116889-70116911 GAAAATAGAGAGAGGGAGATGGG - Intronic
1055002720 9:71470958-71470980 GAAAATACTTAGAGGGGGCCAGG - Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056218407 9:84427465-84427487 GAACATACAGAGGTTGGGCAAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058396021 9:104555485-104555507 CAAAATAGACAAATGGGGCTAGG + Intergenic
1058601144 9:106671777-106671799 GATATTACAGAGATTGGGGTGGG + Intergenic
1058695983 9:107559349-107559371 ACAAATACAGTGATGGGGCCAGG - Intergenic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059040279 9:110807249-110807271 GCAAATACAGAGACAGGGGTGGG - Intergenic
1059309609 9:113378985-113379007 GAATCTACACAGATGGGTCTTGG + Intergenic
1059583698 9:115581934-115581956 GAAAATAAAGGGAAGGGGCTGGG - Intergenic
1060086352 9:120706537-120706559 GAAAATTCAGGGAGGTGGCTGGG + Intronic
1060122446 9:121006546-121006568 GAAAATAAAGACTTGAGGCTGGG + Intronic
1060667609 9:125441830-125441852 TAAAAATCAGAGATGGGGCCGGG + Intronic
1060823494 9:126674434-126674456 GAACAGGCAGAGATGGGGCCTGG + Intronic
1061006801 9:127932859-127932881 AAAAATACAAAAATGGGGCCGGG - Intergenic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1061554988 9:131362018-131362040 AAAAATACAAAAATTGGGCTGGG + Intergenic
1062293974 9:135813939-135813961 GAGAAGACAGAGGCGGGGCTAGG - Intronic
1062654287 9:137594424-137594446 GAAAATAGAGAGGTGGGGCTGGG + Intergenic
1203717049 Un_KI270742v1:162843-162865 GAAAATACAGACATGTGGTTAGG - Intergenic
1203534165 Un_KI270743v1:15391-15413 GAAAATACAGACATGTGGTTAGG + Intergenic
1203651276 Un_KI270751v1:126428-126450 GAAAATACAGACATGTGGTTAGG - Intergenic
1185649167 X:1636245-1636267 GAAAATACTGAGGTCGGGCGCGG - Intronic
1186493689 X:9995013-9995035 AAATATACAGAGAAGAGGCTAGG + Intergenic
1186877840 X:13834343-13834365 AAAAATACAGGAATGTGGCTTGG - Intronic
1187425255 X:19171858-19171880 TAAAAAGCAGAGATGGGGCCTGG + Intergenic
1187455873 X:19440821-19440843 GGAAAAAAAGAAATGGGGCTTGG - Intronic
1187865724 X:23721386-23721408 AAAAAAATAGAGATGGGGCTGGG - Intronic
1189461229 X:41244669-41244691 AAAAATACAGAGAAATGGCTGGG + Intergenic
1189559852 X:42181264-42181286 AAAAATACAGAGATTAGCCTGGG - Intergenic
1190054674 X:47174731-47174753 GGGAAGAGAGAGATGGGGCTCGG - Intronic
1190078678 X:47337989-47338011 AAAAATACAAAAATAGGGCTGGG - Intergenic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1190315999 X:49151523-49151545 AAAAATACAGACAAGGGGCCAGG + Intergenic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1191832157 X:65427622-65427644 CAAAATAGAGGGATGGGGCTGGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192510306 X:71717278-71717300 GAAAATGCAGAGCAGGGCCTGGG - Exonic
1192516391 X:71764275-71764297 GAAAATGCAGAGCAGGGCCTGGG + Exonic
1192529427 X:71872419-71872441 GAAAATGCAGAGCAGGGCCTGGG - Intergenic
1192834068 X:74780670-74780692 GAAAATTTTAAGATGGGGCTAGG - Intronic
1192887689 X:75353334-75353356 CAAAAGGCAGAGATAGGGCTGGG - Intergenic
1193987236 X:88258941-88258963 GAATATAAAGAGTTGAGGCTGGG + Intergenic
1195054265 X:101128037-101128059 AAAAATACAAAAATTGGGCTGGG + Intronic
1195463635 X:105155645-105155667 GAGACTACAGAGAGGGGGCCTGG + Intronic
1197232753 X:124023304-124023326 AAAAATACAGTGGTGGGGGTGGG - Intronic
1197268165 X:124397931-124397953 GAAAAGTCACAGTTGGGGCTGGG + Intronic
1197367843 X:125587655-125587677 AAAAATACAGAGATGTGGGAGGG - Intergenic
1197460176 X:126731277-126731299 GTAAAGTCAGAGATGGGGGTGGG - Intergenic
1197692177 X:129514030-129514052 TAAAATACAAATATGGGGCCAGG + Intronic
1198380662 X:136080268-136080290 AAAAATAATGAGCTGGGGCTGGG + Intergenic
1198435183 X:136610062-136610084 TATAATACAGACATGGAGCTCGG - Intergenic
1198638022 X:138721629-138721651 AAAGATACAGAGATGGAACTAGG - Intronic
1198670752 X:139077874-139077896 GAAAAAAAAGTGATGAGGCTAGG + Intronic
1199559780 X:149150622-149150644 GAAAATACAGAGAAGACACTTGG - Intergenic
1199587400 X:149430694-149430716 GAAAATATTGAGATTGGCCTTGG + Intergenic
1201171232 Y:11267780-11267802 GAAAAGACAGACATGTGGTTAGG - Intergenic
1201271262 Y:12257492-12257514 GTAAATACAGAGCTAGGACTTGG + Intergenic
1202174232 Y:22083043-22083065 AAAAATACAGAGATGAGGCAAGG - Intronic
1202217128 Y:22503339-22503361 AAAAATACAGAGATGAGGCAAGG + Intronic
1202326057 Y:23692731-23692753 AAAAATACAGAGATGAGGCAAGG - Intergenic
1202544714 Y:25977323-25977345 AAAAATACAGAGATGAGGCAAGG + Intergenic