ID: 1000450733

View in Genome Browser
Species Human (GRCh38)
Location 5:161383674-161383696
Sequence AATAAATTGTTCCGCAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000450733 Original CRISPR AATAAATTGTTCCGCAGTGA TGG (reversed) Intronic
901202313 1:7473637-7473659 AAAAGATTCTTCAGCAGTGAGGG - Intronic
903080704 1:20809868-20809890 AATAAAACTTTCCACAGTGATGG - Intronic
907904137 1:58768911-58768933 AGTAAACTGTTGCCCAGTGAAGG + Intergenic
908153291 1:61326707-61326729 AAAAAAGTGTTCCCCAGTGGTGG + Intronic
908317299 1:62945709-62945731 AATAAAGTGTTCAGTTGTGAAGG - Intergenic
908828798 1:68158984-68159006 AATAAAATGCTCCGCAGAGCAGG + Intronic
914251804 1:145927883-145927905 AATAGTTTGATCAGCAGTGAGGG + Intergenic
914948086 1:152084821-152084843 AATAAAATATTCAGCAGTGGGGG - Exonic
915405590 1:155657513-155657535 AATAAGGTGTTCCACTGTGAGGG + Intergenic
917664492 1:177211464-177211486 AACAAATTGTTCCAGATTGAAGG - Intronic
921796839 1:219355100-219355122 AATAAATCTTTCTGCAATGATGG + Intergenic
1064749887 10:18517078-18517100 AATAAAATGTTCTTGAGTGACGG + Intronic
1065367060 10:24946985-24947007 AAAAAATTGTTCTGGTGTGATGG + Intronic
1071385616 10:85117334-85117356 AATGTATTGTTCCACAGTTATGG + Intergenic
1074030344 10:109681469-109681491 AATAAATTGTTCCACGCTGGTGG + Intergenic
1075334640 10:121599399-121599421 AATAAATTATTCCGAAGACACGG - Intergenic
1085360955 11:75886836-75886858 AAAAAATTCTTCTGCCGTGAAGG - Intronic
1086756951 11:90576907-90576929 AATAAATTGTTGGGCATTTATGG - Intergenic
1089926192 11:122260711-122260733 AATAGAATTTTCTGCAGTGATGG - Intergenic
1090527178 11:127549096-127549118 CATAAATTGTTGATCAGTGAGGG + Intergenic
1093533239 12:20192159-20192181 AACAAATTGTTTCGAAGTTATGG + Intergenic
1094210205 12:27881800-27881822 AATAAAACATTCAGCAGTGATGG + Intergenic
1096766005 12:53890389-53890411 AATTAAGTGTTCCTCAGTAAAGG + Intergenic
1097665060 12:62468582-62468604 AATAAAGTATTACCCAGTGATGG + Intronic
1102704453 12:114869155-114869177 AATACATTGTTTTGCAGGGATGG - Intergenic
1109019022 13:57061095-57061117 AATAAATTTCTTGGCAGTGAAGG - Intergenic
1110884229 13:80613064-80613086 ATTAAAATGTCACGCAGTGAAGG + Intergenic
1111981580 13:95021790-95021812 CTTAAATTGTGCCTCAGTGAGGG - Intronic
1112219834 13:97476920-97476942 AATAGAATGTTCTGCAATGATGG - Intergenic
1116528873 14:45941736-45941758 AACAAATTGTTCCTCAATAAGGG + Intergenic
1118392434 14:65306675-65306697 AAGAAATTGATCCCCAGTGTTGG + Intergenic
1120083507 14:80241943-80241965 AATAAAGTGTTTCCCAGAGAAGG + Intronic
1120115746 14:80615581-80615603 AATAAATTGCTAAGAAGTGACGG + Intronic
1120455093 14:84719677-84719699 AATAGATTCTCCCTCAGTGAAGG + Intergenic
1121937967 14:98037787-98037809 AATAAGTTGTTCTGCCGAGATGG - Intergenic
1123895142 15:24821197-24821219 TATAAATTGATCCCCAGTGTTGG + Intergenic
1128589699 15:68884401-68884423 AATTAATTATTCCCCATTGAGGG + Intronic
1133338002 16:5018827-5018849 AATAAATTTTACAGCAGGGAGGG - Exonic
1150665206 17:67128214-67128236 AATAAATTGGTCATCAGTAAAGG + Intronic
1151359492 17:73580125-73580147 AATGAATTGTTCCGCAGTCCTGG - Intronic
1154145676 18:11864417-11864439 AATAATTTGTTCCACTGTAAAGG - Intronic
1155204363 18:23545080-23545102 AATACTTCGTTCAGCAGTGAAGG + Exonic
1155974567 18:32115107-32115129 AATAGATTGTTCTTAAGTGAGGG + Intronic
1156129870 18:33958653-33958675 AATAAAACTTTCTGCAGTGAAGG - Intronic
1158706588 18:59797854-59797876 AAAAAAGAGTTCCCCAGTGAAGG + Intergenic
1159576207 18:70180711-70180733 AATAAACTGTGCCTCAGTTATGG + Intronic
1160382127 18:78467935-78467957 AGTAAATTTGTCAGCAGTGATGG + Intergenic
1163384707 19:16992417-16992439 AATAAATTTTTCTGTAGAGATGG - Intronic
1164401017 19:27902348-27902370 ATTAAGTTGTCCTGCAGTGAGGG + Intergenic
929051881 2:37844300-37844322 ATTAAATTATTCAGGAGTGAGGG - Intergenic
929153253 2:38767329-38767351 ACTACATTGTTCTGCAGTGGAGG + Intronic
932467305 2:71932171-71932193 AATAAATTGTCCCTGTGTGAGGG - Intergenic
935588758 2:104825704-104825726 ATTTAATCGTTCTGCAGTGAAGG + Intergenic
937610408 2:123854734-123854756 GATAAATTATTCCACAATGATGG + Intergenic
941721246 2:168815471-168815493 AATCAATTGTTCCTCTGTAAGGG + Intronic
941829193 2:169935841-169935863 AATAAATTGTTCCAAAATAAAGG - Intronic
942989544 2:182182856-182182878 AATTATTTCTTCCTCAGTGAAGG + Intronic
948001784 2:234573706-234573728 AATACAGTGTCCCGCAGCGAGGG - Intergenic
1169733065 20:8807697-8807719 AATAGAATTTTCTGCAGTGATGG + Intronic
1170036885 20:11998904-11998926 AATAAATCTTTCTGCAGTGATGG - Intergenic
1172757439 20:37296215-37296237 AATAAAGCTTTCTGCAGTGATGG - Intronic
1173325326 20:42027664-42027686 TATAAATAGTTCTGAAGTGAAGG - Intergenic
1173722844 20:45274536-45274558 AAGAAAATATTCCGGAGTGATGG - Intergenic
1174107616 20:48173938-48173960 AATCAATTTTTCCACAGTGGAGG + Intergenic
1177232731 21:18343295-18343317 AGTACATTGTTCCTCAATGATGG + Intronic
1178190971 21:30280485-30280507 AATAAAATGATCCCCAGAGATGG - Intergenic
949462708 3:4310495-4310517 AATAAATTTTTTCCCCGTGATGG - Intronic
956050551 3:65243656-65243678 CATAAAATTTTTCGCAGTGATGG + Intergenic
956631413 3:71320230-71320252 AAGAAATTGTTCAGCTGGGATGG - Intronic
959518516 3:107298682-107298704 AAAAAATTCTTCAGGAGTGAAGG - Intergenic
959523428 3:107346667-107346689 AATACATTGTTCAGCAGTCTGGG + Intergenic
960808845 3:121609699-121609721 AATAAATTCCTCCCCAGTAAGGG + Intronic
962054164 3:131851014-131851036 AATAGATGGTTCTGCAGTGAAGG - Intronic
965001389 3:162958603-162958625 AATAAATAGTTTCACAGTGGTGG + Intergenic
965761943 3:172087725-172087747 CATTAATTTTTCCCCAGTGAGGG - Intronic
967010662 3:185430224-185430246 AATATATTGTTACACAATGATGG - Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
971978938 4:33729358-33729380 ATTAAATTGTTACTCAGTAATGG - Intergenic
972439413 4:39071620-39071642 AATATATTATTCCCTAGTGAAGG - Intronic
974561053 4:63518842-63518864 AATAAATTTTGCCACAATGACGG - Intergenic
976499398 4:85770072-85770094 AATAAATTGTCCATCAGTGCTGG - Intronic
981576091 4:146207415-146207437 AAGAAATTGTTAAGCACTGAAGG + Intergenic
983680585 4:170348934-170348956 AATAAAGTTTTCCACAGAGAGGG - Intergenic
987197254 5:15539135-15539157 AATAAATTGTTCACAAGAGAAGG - Intronic
989726248 5:44589716-44589738 AATAAATTGATCTACACTGAGGG + Intergenic
993523497 5:88934950-88934972 TTTAAATTGGTCCTCAGTGATGG - Intergenic
995536765 5:113144319-113144341 AATAAAATACTCCTCAGTGATGG + Intronic
1000450733 5:161383674-161383696 AATAAATTGTTCCGCAGTGATGG - Intronic
1001309607 5:170601613-170601635 AATAAATAATTCAGCAGTGAAGG + Intronic
1002987469 6:2204686-2204708 AATAAAATTTTCTGCAATGATGG - Intronic
1003546337 6:7062499-7062521 AATACATTGTTCTACAGTGGCGG + Intergenic
1003799472 6:9647241-9647263 AAGAAATTGTTCAGAAATGAGGG - Intronic
1008617477 6:53240518-53240540 AGTAATTTGTTCCTCAGTAATGG - Intergenic
1010929728 6:81786641-81786663 TATAAAATGTCCCGCAGAGAAGG - Intergenic
1017635495 6:156439289-156439311 AAGAATTTGTTCCCCAGGGAGGG - Intergenic
1017651125 6:156583488-156583510 AATAAATTGAAGCACAGTGAAGG - Intergenic
1018928721 6:168225324-168225346 AATAAATTGCTCAGAAGTTATGG + Intergenic
1019960208 7:4452682-4452704 AATAAATTGTCCAGGAATGAAGG - Intergenic
1021083530 7:16391696-16391718 AATAAAACATTCTGCAGTGATGG - Intronic
1021642992 7:22758390-22758412 AATAGATATTTCTGCAGTGATGG - Intergenic
1023191894 7:37591994-37592016 AATAATTTGTTGCACAGTCAGGG - Intergenic
1024627512 7:51220631-51220653 AAGAAAATGTTCCTCAGTGTGGG - Intronic
1026399114 7:69991205-69991227 AATAAACTACTACGCAGTGAAGG - Intronic
1027477699 7:78654002-78654024 AAGAAATTGTTCAGCTGGGAAGG + Intronic
1028468833 7:91182904-91182926 AATAAATTTTTCACCAGAGAGGG + Intronic
1030185664 7:106759292-106759314 AATATATTGGTCATCAGTGAGGG - Intergenic
1040891830 8:52325011-52325033 AATTAATTTTTCAGCAATGAAGG + Intronic
1042299707 8:67263993-67264015 AATAAATAGTTCTGCATTGTTGG + Intronic
1042348715 8:67754020-67754042 AATAAATTATTCCCCATTGATGG + Intergenic
1043502056 8:80868079-80868101 AATAAATTGTTACTCAGTGAAGG - Intronic
1047900722 8:129419278-129419300 AATAAATTGTTACATAGTGTGGG - Intergenic
1048412238 8:134187097-134187119 AATAAATAGCTGCCCAGTGAGGG - Intergenic
1049109170 8:140632655-140632677 ACTAATTTGTTCATCAGTGAAGG + Intronic
1052026297 9:23576988-23577010 AAAAAATTGCTCTGCAGTGAAGG - Intergenic
1053448877 9:38176239-38176261 AAGAAAGTGTTCCAAAGTGAAGG - Intergenic
1055607598 9:77986993-77987015 AAGAAATGGTTCCTAAGTGATGG + Intronic
1058488190 9:105463597-105463619 AATAAAATTTTCCACTGTGATGG - Intronic
1188165570 X:26858727-26858749 AATAAAATGTGTGGCAGTGAAGG - Intergenic
1189600848 X:42623403-42623425 AGTAATTTGTTCCACAGTAATGG + Intergenic
1196423492 X:115545970-115545992 AATAAATTGTTATTGAGTGAAGG - Intergenic
1197347625 X:125344205-125344227 ATTAAATTGATCTGCATTGATGG + Intergenic
1200872854 Y:8122076-8122098 AATAAAATGTATAGCAGTGAAGG + Intergenic