ID: 1000454546

View in Genome Browser
Species Human (GRCh38)
Location 5:161433496-161433518
Sequence GCTACCCAAGAGACTTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33785
Summary {0: 1, 1: 9, 2: 185, 3: 3386, 4: 30204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000454546 Original CRISPR GCTACCCAAGAGACTTAGGT GGG Intronic
Too many off-targets to display for this crispr