ID: 1000457182

View in Genome Browser
Species Human (GRCh38)
Location 5:161464952-161464974
Sequence CTGCTTCTTAATAGCAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000457178_1000457182 24 Left 1000457178 5:161464905-161464927 CCTCAAAGGGCAAGCATGAGAGA 0: 1
1: 0
2: 2
3: 18
4: 244
Right 1000457182 5:161464952-161464974 CTGCTTCTTAATAGCAGTGGTGG 0: 1
1: 0
2: 2
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000457182 Original CRISPR CTGCTTCTTAATAGCAGTGG TGG Intronic
901101504 1:6722602-6722624 TTTCTTCTGAATAGGAGTGGTGG + Intergenic
901283547 1:8058404-8058426 CTTCTTCTTGACAGCAGGGGCGG + Intergenic
902233909 1:15045611-15045633 CTATTTCTTTATAGCAGTGTAGG - Intronic
902316232 1:15621106-15621128 CTGTCTCTTAATAGAAGTGTGGG + Intronic
902632694 1:17714889-17714911 CTGCTCCTTAGGAGGAGTGGGGG + Intergenic
902807694 1:18871418-18871440 CTGTTACTTAATCACAGTGGTGG - Exonic
905544738 1:38788626-38788648 CTTCCTCTCAATAGCAGAGGGGG - Intergenic
908391106 1:63684518-63684540 CTGCTTCTTAGGACCAGAGGTGG + Intergenic
908606986 1:65808635-65808657 CTTTATCTTAATGGCAGTGGGGG + Intronic
909051839 1:70776017-70776039 CTGAAGCTTAACAGCAGTGGGGG - Intergenic
909055075 1:70811061-70811083 GTACTTCTTCATAGCAGTGTGGG + Intergenic
910071301 1:83217107-83217129 CTGCTACTTAATATCAATAGTGG - Intergenic
911337544 1:96598911-96598933 CAGCTTCTTAACAGCAGAGTTGG + Intergenic
913183525 1:116345520-116345542 CTGCCTCTTAACTGCAGTGTGGG - Intergenic
913350652 1:117855071-117855093 CTGATTCTTACCAGCAGTGTTGG - Intergenic
914338837 1:146740899-146740921 CTGGATCTTAATTGCGGTGGTGG - Intergenic
918061863 1:181068651-181068673 CTGCATCCTGATTGCAGTGGTGG + Intergenic
919395495 1:197042402-197042424 CTGGTTCTTAATAGAAGTGCTGG - Intronic
919621356 1:199867639-199867661 CTGCTTCTTGAGAGCACTGCAGG - Intergenic
923478361 1:234358704-234358726 GTAGTTCTTAATAGCAGTGTAGG - Intergenic
1066441118 10:35439961-35439983 CTGGTTATTACTGGCAGTGGAGG + Intronic
1070079238 10:73168934-73168956 CTGGTGCTTAATTGCAGAGGTGG - Intronic
1070404731 10:76084844-76084866 TTGCTCATTAATAGCAGGGGTGG + Intronic
1071763965 10:88640961-88640983 CTGCTTCTTGATCTCAGAGGTGG + Intergenic
1071773903 10:88763055-88763077 CTGCTCCTTAATATGTGTGGTGG - Intronic
1071857603 10:89641985-89642007 CTGCTGCTAAGTAGCAGAGGTGG + Intronic
1071922704 10:90369893-90369915 CTGTTTCTTTATAGCATTGATGG + Intergenic
1072144582 10:92623145-92623167 CTGTATCTTGATTGCAGTGGTGG - Intronic
1072527946 10:96290579-96290601 CAGCTTCTGAGTGGCAGTGGGGG - Intergenic
1073355650 10:102851796-102851818 CTGTATCTTAATAGTGGTGGTGG + Intergenic
1079149895 11:17888202-17888224 CTGCTGCTTTACAGCAGTGGGGG + Intronic
1079671773 11:23179884-23179906 CTTCATCTTACAAGCAGTGGTGG + Intergenic
1081446373 11:43134936-43134958 CTGGATCTCAATAGAAGTGGAGG + Intergenic
1084479696 11:69412461-69412483 GTGCTCATTAATAGCAGTTGGGG + Intergenic
1085245155 11:75095091-75095113 CTGCTGTTTAATAGAAGTGAGGG - Intergenic
1085433124 11:76473687-76473709 TTGCTGCTTAATAGCAGAGTAGG + Intronic
1086092967 11:83022134-83022156 CTTCTTCTTATTAGGGGTGGGGG + Intronic
1087516518 11:99169623-99169645 CGGCTCCTTAATAGAAGTGATGG + Intronic
1087900746 11:103637624-103637646 CTGCATGTGAATAGGAGTGGCGG + Intergenic
1088297374 11:108314647-108314669 CTGATTTTTAATAGCACAGGGGG - Intronic
1089049714 11:115535727-115535749 CTGCTTCTTGCGAGGAGTGGGGG - Intergenic
1090829039 11:130408356-130408378 CTGCTACTTAATAGCTGTGAGGG - Intronic
1091799157 12:3313846-3313868 CTGCTCCTTGCCAGCAGTGGTGG + Intergenic
1098136263 12:67405600-67405622 CAGTTTCTTCATAGCATTGGTGG - Intergenic
1098551496 12:71766962-71766984 CTGCTTCTTTATAAAAGTTGGGG - Intronic
1099072077 12:78057763-78057785 CTGCTACTTACTAGCTGTGTGGG - Intronic
1099284289 12:80696637-80696659 GTGTTTTTTAAAAGCAGTGGTGG - Intergenic
1099378229 12:81920559-81920581 CTGCTTCATCTTAGCAGAGGTGG + Intergenic
1101681963 12:106977520-106977542 TTGCTTCTTTCTAGCAGTGCAGG - Intronic
1103454635 12:121055322-121055344 CTCCATCTTGATTGCAGTGGTGG - Intergenic
1103718891 12:122962902-122962924 CAGCTTCTGAATAGCAGAGCTGG + Intronic
1105675036 13:22661910-22661932 CTGCCTCTAAAATGCAGTGGTGG - Intergenic
1107723100 13:43270132-43270154 CTGCTTAAAAATAGCAGTGTAGG - Intronic
1107809729 13:44188769-44188791 CTGCTTCTTAATGCCAGAGTAGG + Intergenic
1108428368 13:50328348-50328370 CTGCTTCTTTCTAGCTATGGTGG + Intronic
1109914930 13:68970806-68970828 ATGCTGCTTTATAGCAGTTGAGG - Intergenic
1111430987 13:88147784-88147806 CTGAAATTTAATAGCAGTGGGGG + Intergenic
1114198541 14:20501279-20501301 CTGTATCTTGATTGCAGTGGTGG - Intergenic
1116699342 14:48219144-48219166 CTGCTTATTAATAACAGTTGGGG - Intergenic
1117099369 14:52331043-52331065 CTGATTCTCAATGGCGGTGGTGG + Intergenic
1117226218 14:53662890-53662912 CTACATCTTGATTGCAGTGGTGG + Intergenic
1118003769 14:61547098-61547120 CTACTTCGAAACAGCAGTGGTGG + Intronic
1120870241 14:89330190-89330212 CTGTTTGTCAATAACAGTGGAGG + Intronic
1121393549 14:93597450-93597472 CTGCTTCCTGACAGCAGTGGAGG + Exonic
1123976522 15:25559177-25559199 CTGATTTTTAATTGCAGTGGGGG + Intergenic
1128002565 15:64207020-64207042 CTGCTACATAATGGTAGTGGAGG + Intronic
1132360601 15:101210596-101210618 CTGCATCTTAAGAGCAGGGGTGG + Intronic
1134240000 16:12498924-12498946 CTGCTACTTGATAGCAGAAGGGG + Intronic
1135539316 16:23317726-23317748 TTGCTTCTAAATAGCAGTAAAGG + Intronic
1135745793 16:25015250-25015272 CTGCTTCTTCATGGCGGCGGTGG + Exonic
1135757022 16:25106989-25107011 CTGCTTCTTCAAGGCAGCGGCGG + Intergenic
1136020369 16:27436298-27436320 CTCCTTCTCACTAGCAGTTGTGG - Intronic
1136983931 16:35082844-35082866 CTGCTTGTTAAGAGCAATTGTGG + Intergenic
1138253220 16:55524457-55524479 TTGTGTCTTAATTGCAGTGGTGG + Intronic
1138619467 16:58199190-58199212 CAGCTTCTAAGTAGCAGTGCTGG - Intergenic
1139074004 16:63420683-63420705 CTGCAACTTATTAGCAATGGAGG - Intergenic
1139190185 16:64854465-64854487 CTGTGTCTTTATTGCAGTGGTGG + Intergenic
1139995442 16:70976453-70976475 CTGGATCTTAATTGCGGTGGTGG + Intronic
1142272520 16:89097754-89097776 CTGCCTCTGAACAGCTGTGGAGG + Intronic
1142373606 16:89695994-89696016 CTGCTTCTTGGGAGGAGTGGTGG + Exonic
1143449278 17:7026221-7026243 CTCCTCTTCAATAGCAGTGGTGG - Intronic
1150021642 17:61621128-61621150 CTGTATCTTTATTGCAGTGGTGG - Intergenic
1150575555 17:66427391-66427413 CTGCTTTTGCATTGCAGTGGTGG + Intronic
1151098425 17:71526894-71526916 ATTATTCTTAATTGCAGTGGTGG + Intergenic
1153099617 18:1451680-1451702 CAGCATATTACTAGCAGTGGTGG + Intergenic
1155519026 18:26650915-26650937 CTTCTTCTTAATAGCAGCGTTGG + Intronic
1156083583 18:33371652-33371674 CTCCTTCATAATATCAGTGCTGG + Intronic
1156226691 18:35116681-35116703 CTGCTTCTTCAGGGCAGTAGGGG + Intronic
1156322656 18:36041859-36041881 CTGCTTCTCCACAGCAGAGGTGG + Intronic
1160146426 18:76369184-76369206 ATGCTTCCTAACTGCAGTGGAGG + Intronic
1165291390 19:34888889-34888911 CTGCCTCTTCATGGCAGTGAAGG + Intergenic
1165733716 19:38162815-38162837 CTGCGTCTTTCCAGCAGTGGAGG + Intronic
926428511 2:12762500-12762522 CTGCTTCTTACTAGCTGTCTTGG - Intergenic
929675044 2:43917961-43917983 CTTCTTTCTAATAGCAGTGTGGG - Intronic
936910076 2:117581302-117581324 CAGTTTCTTCATAGCATTGGTGG - Intergenic
940151788 2:150610371-150610393 CTCCTTCAGAATATCAGTGGTGG - Intergenic
942102895 2:172603612-172603634 CTGGCACTTTATAGCAGTGGTGG + Intronic
943284033 2:185974164-185974186 CTAGTTCTTTATAGCAGTGTTGG - Intergenic
944468694 2:200030112-200030134 CAGCTTTTTAATCTCAGTGGTGG + Intergenic
944664388 2:201947625-201947647 CTGTTTCTTAAAAGCAGAAGAGG + Intergenic
945486674 2:210405315-210405337 CTGTTTCTTCATAGCATTGATGG + Intergenic
945594329 2:211773122-211773144 CTGGGTCTTAAAAGCAGTTGAGG + Intronic
1174643931 20:52069638-52069660 ATACTTCTTAAGAGGAGTGGTGG + Intronic
1178004688 21:28204888-28204910 CTGCTTGTAAATAGGAGTGATGG - Intergenic
1179423169 21:41252131-41252153 CTGCTTACTCATAGCAGGGGAGG - Intronic
1180762630 22:18221525-18221547 CTGCTTCTGAAGGGCGGTGGGGG - Intergenic
1180773037 22:18403083-18403105 CTGCTTCTGAAGGGCGGTGGGGG + Intergenic
1180804395 22:18652638-18652660 CTGCTTCTGAAGGGCGGTGGGGG + Intergenic
1180806358 22:18716778-18716800 CTGCTTCTGAAGGGCGGTGGGGG - Intergenic
1181020953 22:20102175-20102197 CTGCATCTTGATTGCAGTGTTGG - Intronic
1181217304 22:21342559-21342581 CTGCTTCTGAAGGGCGGTGGGGG - Intergenic
1184790162 22:46695274-46695296 CTGTCCCTTCATAGCAGTGGTGG + Exonic
1185231971 22:49688612-49688634 GTGCTGCTGACTAGCAGTGGGGG + Intergenic
1203234871 22_KI270731v1_random:144071-144093 CTGCTTCTGAAGGGCGGTGGGGG + Intergenic
952661971 3:35862654-35862676 TTGCATCTTAATAGCAGTGGTGG - Intergenic
955742170 3:62102964-62102986 CTGATTTTTAGTACCAGTGGGGG - Intronic
956081202 3:65558157-65558179 CTGCTTATTAATAGACGTAGAGG + Intronic
956767640 3:72497345-72497367 CTGGTTCTTAATAGCTCTGCTGG - Intergenic
957400633 3:79708150-79708172 CTGTTTCTTAAAAGCAGGAGAGG + Intronic
958738143 3:98033855-98033877 CTGATTTTTAATCGCAGTGCAGG + Intronic
959045487 3:101468771-101468793 CAGTTTCTTCATAGCACTGGTGG - Intronic
959670074 3:108966921-108966943 ATGATTCATAATAGCATTGGTGG - Intronic
961522152 3:127473103-127473125 CTGCTTCATAACTGCAGTGCTGG - Intergenic
963648969 3:147953040-147953062 CTGTGTCTTCATTGCAGTGGTGG + Intergenic
963672127 3:148264508-148264530 CTGATTCTTAATGGAATTGGAGG + Intergenic
964742495 3:159982232-159982254 CAACTTCTCAATAGCGGTGGAGG - Intergenic
965795122 3:172431548-172431570 CTTTTTCTTAAAAGCAGTTGAGG - Intergenic
967197297 3:187039511-187039533 CTGCTTCTGAAGGTCAGTGGAGG - Intronic
967351461 3:188518247-188518269 CTTCTTTCTAATATCAGTGGGGG - Intronic
967409445 3:189152610-189152632 CTACTTTTTAATAGTAATGGCGG - Intronic
968128924 3:196180578-196180600 CAGCATCTTGATTGCAGTGGTGG + Intergenic
972212549 4:36856292-36856314 CAGTTTCTTCATAGCATTGGTGG - Intergenic
973599162 4:52523935-52523957 CAGTTTCTTAATAGCAGTGATGG - Intergenic
974065457 4:57073065-57073087 GTGCTTCTTAAAAGCTGTGGGGG - Intronic
979660785 4:123252710-123252732 CTGCACCTTAATTGCAGAGGTGG - Intronic
979851291 4:125573810-125573832 CTTCTGCTTAAGAACAGTGGAGG - Intergenic
980141497 4:128923137-128923159 CTGTATCTTAATTGCAGCGGTGG - Intronic
980467711 4:133206419-133206441 CTGCTTCTTAATAACATTTTTGG + Intronic
981632720 4:146839614-146839636 CTGTATCTTGATTGCAGTGGTGG - Intronic
982429665 4:155308358-155308380 CTCCTTCTTCATAGCATTGTTGG + Intergenic
982454129 4:155587602-155587624 CTGCTTATAAATGGCAGTGATGG - Intergenic
983991738 4:174128021-174128043 CTGATTGTCAATGGCAGTGGAGG - Intergenic
984895282 4:184533649-184533671 CAGGTTCTTAATAGGAGAGGGGG - Intergenic
986028875 5:3876676-3876698 CTTTTTCTTAATAGTAGTGATGG + Intergenic
988030096 5:25752871-25752893 CTGATGTTTAACAGCAGTGGGGG + Intergenic
996569996 5:124922955-124922977 CTGCTTCTTAATCACAGTAGTGG - Intergenic
996956495 5:129188593-129188615 ATGCAGCATAATAGCAGTGGTGG + Intergenic
997590308 5:135068173-135068195 CTGCTTCTTCATGGCAGGGCAGG + Intronic
999683459 5:154081519-154081541 CTGCTCCTTGCTGGCAGTGGTGG - Intronic
1000457182 5:161464952-161464974 CTGCTTCTTAATAGCAGTGGTGG + Intronic
1002594142 5:180311376-180311398 CTGGTTCTTAATATATGTGGTGG + Intronic
1003627730 6:7758604-7758626 CTTCTTTTGAATAGCTGTGGTGG + Intronic
1010920124 6:81670777-81670799 GGGCTTCCTAAAAGCAGTGGTGG - Intronic
1013937603 6:115616949-115616971 CTGCTTCTCAATACCAATTGTGG + Intergenic
1014885082 6:126770162-126770184 ATGCTTCTTTATAGCCTTGGTGG + Intergenic
1016102253 6:140116788-140116810 CAGTTTCTTCATAGCATTGGTGG - Intergenic
1016687480 6:146897971-146897993 CTGAATCTTCATAGGAGTGGAGG - Intergenic
1017261398 6:152391798-152391820 CTGCATCCAAATAGCAGTGGTGG + Intronic
1019315789 7:385779-385801 CTGCCTCTTGACTGCAGTGGGGG + Intergenic
1021761069 7:23903672-23903694 CTATTTCTTTATAGCAGTGGGGG - Intergenic
1023392746 7:39726036-39726058 CTGCATCTTAATTGTGGTGGTGG + Intergenic
1023523994 7:41079710-41079732 CTGCTTATTAATGACAATGGTGG - Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1023809815 7:43903109-43903131 TTTTTTTTTAATAGCAGTGGGGG - Intronic
1024127584 7:46316170-46316192 CTGCTACTCGATAGCAGAGGAGG + Intergenic
1024971094 7:55071138-55071160 CTACTTCTTCCTAACAGTGGTGG - Intronic
1028513618 7:91651906-91651928 CTACTTAATAATAACAGTGGTGG + Intergenic
1029154766 7:98508333-98508355 CTGTATCTTGATTGCAGTGGTGG + Intergenic
1029801687 7:102954455-102954477 CAGTTTCTTCATAGCAGTGATGG - Intronic
1029902907 7:104060847-104060869 CAGCTTCTTCATAGCATTGATGG - Intergenic
1030359717 7:108582149-108582171 TTGCTTCTTAGTAGCTGTGTTGG + Intergenic
1031496906 7:122461000-122461022 CTGCTTCTGCACAGCAATGGCGG + Intronic
1033244924 7:139709774-139709796 CTATTTCTTTATAGCAGTGGTGG + Intronic
1034524311 7:151647124-151647146 CTGTTTCTCAATAGCAGTCAGGG - Intronic
1035680182 8:1482277-1482299 CTGCTTCTTGATAGCTGGGCAGG + Intergenic
1035817247 8:2554195-2554217 GTATTTCTTAATAGCAGTGAAGG + Intergenic
1039036232 8:33362332-33362354 CAGTTTCTTCATAGCATTGGTGG - Intergenic
1040660456 8:49569347-49569369 CTGTGTCTTAATTGCACTGGTGG + Intergenic
1041012291 8:53557237-53557259 CTGCTTCTCAATGGCATAGGAGG + Intergenic
1041043692 8:53871680-53871702 CTGCTTCTAAATAACACTAGAGG + Intronic
1041815693 8:61968388-61968410 CAGCTTCTTCATAGCATTGATGG + Intergenic
1045615417 8:103904019-103904041 CTTCATCTTTATAGAAGTGGTGG - Intronic
1049050098 8:140187942-140187964 CAGGTTCTTAAAAGCAGTGATGG + Intronic
1049321305 8:141997987-141998009 CTGCTTCTCGACAGCTGTGGAGG - Intergenic
1050590880 9:7159410-7159432 CAGTTTCTTCATAGCATTGGTGG + Intergenic
1053030391 9:34771672-34771694 CTGTACCTTGATAGCAGTGGTGG - Intergenic
1053089442 9:35260833-35260855 TTGCTTCTCATTAGCAGTCGTGG - Intronic
1056488608 9:87083785-87083807 TTGCTTCTAAAAAGAAGTGGCGG + Intergenic
1057268565 9:93634421-93634443 CTGCTTCTTAAGAGCTGAGATGG - Intronic
1057788670 9:98108003-98108025 CTGCATTTTGATTGCAGTGGTGG + Intronic
1058365604 9:104205048-104205070 CTGAATGTTTATAGCAGTGGAGG + Intergenic
1059188027 9:112294584-112294606 CTTGTTCTTAATTGCAATGGAGG - Intronic
1059935052 9:119301590-119301612 CTGTCTCTTGATCGCAGTGGTGG + Intronic
1060230118 9:121819851-121819873 GTGCTTCTTATTAGGAATGGAGG + Intergenic
1061603173 9:131686322-131686344 CTGTTTCTTAAAAGCAGGGATGG - Intronic
1061779033 9:132984977-132984999 CTGCTTCAGAACAGCAGTGAGGG - Intronic
1062577861 9:137216909-137216931 CAGCTCCTTGAGAGCAGTGGGGG + Exonic
1189029043 X:37430825-37430847 CTGCTACTTGATTGCAGTGATGG - Intronic
1189566325 X:42245262-42245284 CTGCTTCTTCCAAGCAGAGGTGG - Intergenic
1193063426 X:77231402-77231424 CTCTATCTTGATAGCAGTGGTGG + Intergenic
1195852054 X:109294510-109294532 CTGCTTGGTCATAGCAGTGGGGG - Intergenic
1196166751 X:112543776-112543798 CTCCTTCTTAATACCAGTGGTGG - Intergenic
1199329391 X:146541833-146541855 CTATTTCTTTATAGCAATGGAGG - Intergenic
1199851559 X:151727675-151727697 CTGCATATGAGTAGCAGTGGAGG + Intergenic
1199948424 X:152685918-152685940 CTTCTTCTAAATAGCAGTCAGGG - Intergenic
1199961255 X:152782538-152782560 CTTCTTCTAAATAGCAGTCAGGG + Intergenic