ID: 1000462597

View in Genome Browser
Species Human (GRCh38)
Location 5:161541520-161541542
Sequence CAATTTATGCAGAAGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000462597 Original CRISPR CAATTTATGCAGAAGATGCA AGG (reversed) Intronic
903375689 1:22864401-22864423 CATTTTAGGCAGCAGAAGCAGGG + Intronic
906721914 1:48012906-48012928 CAACAGATGCAGAAAATGCAAGG - Intergenic
906758445 1:48346143-48346165 GACTTTATCCAGAAGGTGCAAGG + Intronic
906775402 1:48524938-48524960 CACTTTATCCAGAAGTTTCAGGG + Intergenic
907878688 1:58522155-58522177 CAATACAGGCAGAAAATGCAGGG + Intronic
908355142 1:63321018-63321040 AAATATTTGCAGAAGATGCTGGG - Intergenic
909294038 1:73922986-73923008 CATTTTATCCAGACAATGCATGG + Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
912001152 1:104836416-104836438 TAATTTATGTATAAGATGTAAGG - Intergenic
912967195 1:114246772-114246794 CAATTTTTGTAGAAGTTGTAAGG - Intergenic
913402362 1:118449883-118449905 CAATTAAGGCAGAAGTTGAAGGG - Intergenic
913780201 1:122376278-122376300 CACTTTTTGTAGAATATGCAAGG + Intergenic
916103326 1:161411626-161411648 GAATTTATGCAGACAATTCAAGG - Intergenic
916304925 1:163319605-163319627 GAATTTATAGACAAGATGCACGG + Intronic
917008549 1:170444585-170444607 CAGATTGTGCAGAAGAAGCAGGG - Intergenic
918094802 1:181325794-181325816 AAATATTTGCAGAAGATGCTGGG - Intergenic
920016494 1:202914380-202914402 CAATTGTTGGATAAGATGCAGGG + Intronic
921724964 1:218513645-218513667 CAAATTATGCAAAAGATCTATGG - Intergenic
921886245 1:220309490-220309512 TAATTTTTGCATAAGGTGCAAGG - Intergenic
922397107 1:225213075-225213097 TAATTTATGTATAAGATGTAAGG + Intronic
923097297 1:230785588-230785610 CAATTATTGCAGAAGGTGAAGGG - Intronic
924097642 1:240570484-240570506 CAAATTAAGCAGAATATGGAAGG + Intronic
1063080876 10:2766091-2766113 CTCTTCATGCAGAACATGCAGGG - Intergenic
1063172503 10:3522032-3522054 CAATTTATTTAGAAGATTAATGG - Intergenic
1063294834 10:4794752-4794774 TAATTTTTGCATAAGGTGCAAGG + Intronic
1063468052 10:6261029-6261051 CAAGTGATGGTGAAGATGCAGGG - Intergenic
1066519741 10:36202761-36202783 CAATAGATGCAGAAAAAGCATGG - Intergenic
1066816181 10:39417333-39417355 CAATTTTTGTAGAATCTGCAAGG + Intergenic
1066974465 10:42354008-42354030 TAATTTTTGTAGAAGATGTAAGG - Intergenic
1067663398 10:48253276-48253298 TAATTTTTGCATAAGGTGCAAGG - Intronic
1067740244 10:48890062-48890084 AAACATGTGCAGAAGATGCACGG - Intronic
1067918108 10:50422242-50422264 CTATTTATGCAGAATCTGCTAGG - Intronic
1068355948 10:55908298-55908320 CAATTATGGCAGAAGATGAAGGG + Intergenic
1068436397 10:56997012-56997034 GAATTTATTCCGAAGATGCAAGG + Intergenic
1069673412 10:70230335-70230357 CAATTTATGCAGATAAGGTAAGG - Exonic
1071921925 10:90360138-90360160 CAATTATTGCAGAAGGTGAATGG + Intergenic
1072996910 10:100253357-100253379 AAGTTTATACAGAAGATCCATGG + Intronic
1073518207 10:104098105-104098127 CAATTTATTCAGAGAATACAAGG - Intergenic
1074277239 10:112015122-112015144 CAACCTCTGCAGAAGTTGCAGGG + Intergenic
1077416230 11:2425574-2425596 CACTTAATGCAGAACAGGCAGGG + Intergenic
1077781799 11:5338179-5338201 TAATTTATGTATAAGATGTAAGG + Intronic
1078118872 11:8485263-8485285 CAATTTTTGCAGAAGAGGTCTGG - Intronic
1078917918 11:15797492-15797514 AAATTTATCCAGAATATCCATGG + Intergenic
1079277733 11:19057382-19057404 CAGTTTATGGAGAGGATTCAGGG + Intronic
1082159878 11:48879288-48879310 CGATTTTTGCAGAATCTGCAAGG + Intergenic
1082512186 11:53840675-53840697 CACTTTCTGTAGAATATGCAAGG + Intergenic
1084258679 11:67959698-67959720 CAATTTGTCAAGAAGCTGCACGG + Intergenic
1084814068 11:71635481-71635503 CAATTTGTCAAGAAGCTGCACGG - Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1086610840 11:88753832-88753854 CAATTATGGCAGAAGATGAAAGG + Intronic
1086659788 11:89401194-89401216 TATTATATGCAGAAGAGGCATGG - Intronic
1086943540 11:92822439-92822461 CATTTTCTGCAGAAAATCCAAGG + Intronic
1089288505 11:117422890-117422912 TAATTTATGCAGGAGATGAAGGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089519316 11:119053189-119053211 CAATGCCTGCAGAACATGCATGG + Intronic
1090308227 11:125709936-125709958 TAATTTTTGTATAAGATGCAAGG - Intergenic
1090626142 11:128610622-128610644 TAATTCATGCTGAAAATGCAAGG + Intergenic
1090713842 11:129412603-129412625 CAATTTATGCAGAAATTTCTAGG + Intronic
1090956909 11:131521353-131521375 AAATAAATGCAGAAGAAGCAAGG + Intronic
1090991812 11:131824300-131824322 CAAATTATGTAGAAGTTGTAGGG - Intronic
1092430009 12:8400708-8400730 CAATTTGTCAAGAAGCTGCATGG + Intergenic
1092491845 12:8952575-8952597 TCATTTATAGAGAAGATGCAAGG + Intronic
1092763275 12:11828843-11828865 AAATTAATGCAGAAAATGTATGG - Intronic
1092928079 12:13290307-13290329 CTATTCATCCAGAAGATGCCAGG - Intergenic
1093899467 12:24613701-24613723 CAATTTATCCCTGAGATGCAAGG + Intergenic
1095045758 12:37502272-37502294 CAGTTTATGGAGATGAAGCAAGG - Intergenic
1096006648 12:48178754-48178776 TAATTTATGGAAAAGATGGAAGG + Intronic
1097840502 12:64316924-64316946 TAAATTATGCAGCAGATGCATGG - Intronic
1098139726 12:67439108-67439130 CAATTATGGCAGAAGATGAAGGG - Intergenic
1098717275 12:73846384-73846406 TAATTTTTGTAGAAGATGTAAGG + Intergenic
1100717314 12:97319441-97319463 CAGTTTAGGGAGAATATGCAAGG - Intergenic
1102905684 12:116673662-116673684 CAGTTTATGCAGAAATTTCAAGG + Intergenic
1104694424 12:130852582-130852604 CAATTCCTGCAGAGGATGCCAGG - Intergenic
1106316456 13:28598646-28598668 CAAGTGAGGCAGAAGCTGCAAGG + Intergenic
1107272581 13:38637810-38637832 CAAAGTATACAGAAGAAGCATGG + Intergenic
1108784520 13:53879344-53879366 AAATTTATGAAGAAGAACCATGG - Intergenic
1109569011 13:64161780-64161802 CTATTTATGTAGAAGGTGAAGGG - Intergenic
1111144308 13:84160013-84160035 CAATTTGTGAAGAAGAAGCATGG + Intergenic
1113996814 14:16091298-16091320 CACTTTTTGCAGAATCTGCAAGG - Intergenic
1113996825 14:16091469-16091491 CACTTTTTGCAGAATCTGCAAGG - Intergenic
1114051811 14:18925491-18925513 CAATTTATTCAGCAAATGCAGGG + Intergenic
1114110748 14:19476430-19476452 CAATGTATTCAGCAAATGCAGGG - Intergenic
1114433434 14:22682773-22682795 TAATTTTTGTAGAAGATGTAAGG - Intergenic
1114990056 14:28274965-28274987 CAATTTTTAAAGAAGCTGCAGGG - Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1116643826 14:47500838-47500860 CAAATTATTCAGAAAAAGCAGGG - Intronic
1116705532 14:48293719-48293741 GTATTTCTGAAGAAGATGCATGG - Intergenic
1117462851 14:55963547-55963569 CACTTTAAGCAGATGCTGCATGG - Intergenic
1117496705 14:56312715-56312737 CCATTTCTGCAGGAGATGCTAGG - Intergenic
1119843435 14:77810472-77810494 ATAATTATGCAGAAGCTGCAAGG + Intronic
1120041219 14:79754939-79754961 CAATTATGGCAGAAGATGAAGGG - Intronic
1120440755 14:84535848-84535870 CAAATAATACAGAAGATGCCTGG - Intergenic
1122446745 14:101775408-101775430 CAATCTGTGCAGCAGATACATGG - Intronic
1123219532 14:106843145-106843167 CAAAATTTGCAGAAGATGGAAGG - Intergenic
1124153375 15:27202559-27202581 CAATTTCTGGTGAAGATGTAGGG - Intronic
1125014965 15:34923598-34923620 TAATTTATGTATATGATGCAAGG + Intronic
1125653538 15:41337395-41337417 CCATTTATGCTGAAGATCCTGGG + Intronic
1126054553 15:44717688-44717710 CACTTTATGCACAAAATGTAGGG + Exonic
1130872571 15:87982925-87982947 GAGTGTAGGCAGAAGATGCAGGG - Intronic
1135336858 16:21609003-21609025 CCATTTATTCAGAAATTGCAAGG + Intronic
1138812604 16:60168381-60168403 CAGTTTAGGCAGATGCTGCAAGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1145452401 17:23267573-23267595 CACTTTCTGCAGAATCTGCAAGG + Intergenic
1147798897 17:43067560-43067582 GGTTTTATGCAGCAGATGCAAGG + Intronic
1148454579 17:47804218-47804240 CACTTTATTCAGAAGATGCAAGG + Intergenic
1151855446 17:76718276-76718298 CAGGTTCTGCAGAAGATGCCGGG + Intronic
1153262761 18:3240504-3240526 CAATTATGGCAGAAGATGAAAGG - Intergenic
1153299154 18:3577533-3577555 AAATTTGTTCAGAAGACGCATGG + Intronic
1153560303 18:6365708-6365730 GCATTTTTGCAGAAGATGGAAGG - Intronic
1153798886 18:8650847-8650869 CAATTTTTGTATAAGGTGCAAGG - Intergenic
1153941058 18:9977757-9977779 CAATTTTTGTATAAGATGTAAGG + Intergenic
1154518921 18:15205383-15205405 TAATATATTCAAAAGATGCAAGG - Intergenic
1154920617 18:20799560-20799582 CTCTTTTTGTAGAAGATGCAAGG + Intergenic
1155404288 18:25470752-25470774 AAATTTATGCAGCACATACAGGG + Intergenic
1155583209 18:27335734-27335756 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1155718859 18:28985091-28985113 CAAAATCTGCAGAAGATACAGGG - Intergenic
1155774974 18:29749939-29749961 CTAGTTATGCAAAAAATGCAAGG - Intergenic
1157048502 18:44132249-44132271 CCATTTATGAAGAATATTCATGG + Intergenic
1157968892 18:52242518-52242540 CAATTTCTGGAGAAGAGGAAGGG - Intergenic
1158187132 18:54783629-54783651 CAATTTATTGTGAGGATGCACGG + Intronic
1159846721 18:73469935-73469957 TAATTTTTGCAGAAGGTGTAAGG + Intergenic
1164537620 19:29098118-29098140 CAATTTCCGCAGAAGTTACAAGG - Intergenic
1164538935 19:29107814-29107836 CAATACATGCAGAATATGCAAGG - Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
925685594 2:6469679-6469701 CAATTATGGCAGAAGATGAAGGG + Intergenic
927357653 2:22191661-22191683 ATATTTATGTAGAAGATGAATGG + Intergenic
929113229 2:38422794-38422816 CAATTTGTGCAGCACATACAAGG - Intergenic
930329086 2:49959670-49959692 CAATCTATGCAGTAGTTGTAGGG + Intronic
933116465 2:78479177-78479199 TAATTTTTGTATAAGATGCAAGG - Intergenic
933343726 2:81055506-81055528 CAAATTATGCATCAGATGAAAGG - Intergenic
934811319 2:97280094-97280116 TAATTTTTGCATAAGATGTAAGG - Intergenic
934826371 2:97427846-97427868 TAATTTTTGCATAAGATGTAAGG + Intergenic
935799066 2:106674642-106674664 TAATTTTTGCATAAGATGTAAGG + Intergenic
935836626 2:107062212-107062234 GAATGTGTGCAGAAGAGGCAAGG + Intergenic
936692449 2:114906684-114906706 GAATTTATCCTGAGGATGCAAGG - Intronic
936784040 2:116071718-116071740 CCATATATGTAGAAGATACATGG - Intergenic
939487198 2:142829391-142829413 TAATTTTTGCACAAGATGGAAGG + Intergenic
939683147 2:145163647-145163669 TAATTTATGCCAAAGATGTATGG + Intergenic
940353478 2:152715361-152715383 CAATTTATGCTAGAGATGGAAGG + Intronic
943389241 2:187242744-187242766 TAATTTGTGCATAAGAGGCAGGG - Intergenic
943879402 2:193120581-193120603 CTACTTAGGCAGAAGATGAATGG + Intergenic
946290592 2:218741621-218741643 CAATTTATGCATCAGACTCAGGG - Intronic
947057185 2:226118561-226118583 CAAATTACAGAGAAGATGCACGG + Intergenic
947287988 2:228539487-228539509 AAATTTATGCATAAAATGCTTGG - Intergenic
948738673 2:240027677-240027699 TGGTTTATTCAGAAGATGCAAGG + Intergenic
1171200511 20:23237378-23237400 TAATTTCTGCATAAGCTGCAAGG + Intergenic
1172598859 20:36169693-36169715 CCATTTAGACAGGAGATGCAGGG - Intronic
1173049861 20:39548765-39548787 CAATTTATGCAGAAATTTCTAGG - Intergenic
1174197506 20:48783994-48784016 CAAATCCTGCAAAAGATGCAGGG + Intronic
1175025800 20:55901391-55901413 TAATTTTTGCATAAGATGTAAGG + Intergenic
1177967178 21:27742411-27742433 CAATTTATGCAGAATATCATTGG + Intergenic
1178216811 21:30607913-30607935 TAATTTTTGCATAAGGTGCAAGG - Intergenic
1180310099 22:11215807-11215829 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1180310110 22:11215978-11216000 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1180470284 22:15647870-15647892 CAATTTATTCAGCAAATGCAGGG + Intergenic
950362644 3:12460778-12460800 CAATTTATTCAGAAGGTACGAGG + Intergenic
951090248 3:18564359-18564381 CAATGTATGAAAAATATGCATGG + Intergenic
951180803 3:19655945-19655967 CAATCATTGCAGAAGATGAAGGG + Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
951922072 3:27866248-27866270 CAATTTATCCCTCAGATGCAAGG - Intergenic
952347934 3:32505641-32505663 CAATTTATGAAGAAAATGTAAGG - Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
952694985 3:36254453-36254475 TAATTTTTGCATAAGATGTAAGG - Intergenic
953302140 3:41788286-41788308 CATTTAAAGCAGAAGAAGCATGG + Intronic
953456422 3:43045915-43045937 CAATTATGGCAGAAGATGAAGGG - Intronic
954293541 3:49662174-49662196 CACTGTATGCAGAAGGTGCCCGG - Exonic
956724144 3:72143280-72143302 CAATTCAGACAGAACATGCAGGG - Intergenic
959657961 3:108831437-108831459 CAATTCATGTTGAATATGCATGG + Intronic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
960722642 3:120639990-120640012 CAATTAATGCTAAAGAAGCAGGG - Intronic
961025730 3:123554953-123554975 CAATTGCTATAGAAGATGCAAGG + Intronic
961280445 3:125762506-125762528 CAATTTGTCAAGAAGCTGCACGG - Intergenic
961873952 3:130007030-130007052 CAATTTGTCAAGAAGCTGCACGG + Intergenic
961973559 3:130996135-130996157 TAATTTATCCAGAAGACCCATGG - Intronic
962430904 3:135318898-135318920 CCATTTGTGCAGAAGATGATTGG - Intergenic
962642022 3:137397484-137397506 TAATTTTTGCACAAGATGTAAGG - Intergenic
964690974 3:159449330-159449352 CAATAAATGCAGAAGAGGGAAGG + Intronic
965148195 3:164933768-164933790 CAGTTTATGGAAAAGATGAAAGG + Intergenic
965856170 3:173090302-173090324 CAATTATTGCAGAAGGTGAAAGG - Intronic
965986119 3:174755220-174755242 CAATTACGGCAGAAGATGAAGGG - Intronic
969017228 4:4111526-4111548 CAATTTGTCAAGAAGCTGCACGG + Intergenic
969736731 4:8996775-8996797 CAATTTGTCAAGAAGCTGCACGG - Intergenic
973608115 4:52607803-52607825 CAATTATGGCAGAAGATGAAGGG - Intronic
973892550 4:55381880-55381902 CTATTTGTGCAGATGATGCGGGG - Intergenic
974761281 4:66277266-66277288 CATTTTAAAAAGAAGATGCATGG + Intergenic
975076545 4:70216319-70216341 TAATTTATGCAGTAGAAGCTGGG + Intergenic
975076988 4:70221983-70222005 TAATTTATGCAGTAGAAGCTGGG - Intergenic
975191147 4:71464082-71464104 CAGTGTATGCATAAGATGAAAGG - Intronic
975343286 4:73265253-73265275 CAATTTAGCCAGAATAAGCATGG + Intergenic
975390352 4:73809205-73809227 GGATTTATCCATAAGATGCAAGG + Intergenic
976105435 4:81612354-81612376 AGAGGTATGCAGAAGATGCAGGG + Intronic
976900079 4:90162686-90162708 AAATTAATTCAGAAGCTGCAGGG + Intronic
977209059 4:94196648-94196670 CAATTTTTGTAGAAGAAGCCAGG - Intergenic
977689605 4:99892291-99892313 AAGTTTATTGAGAAGATGCATGG + Intronic
978042769 4:104090694-104090716 ATATTTGTGCAGAAGCTGCAAGG + Intergenic
980027670 4:127785197-127785219 CAACTTATGCAGGAGATGAGAGG - Intronic
981499310 4:145432004-145432026 CAATTTTTGTAGAAGATGTGAGG + Intergenic
982382978 4:154770023-154770045 CAATTATGGCAGAAGATGAAGGG + Intergenic
983888710 4:173009014-173009036 CAATTTATGGAGAAAAATCAAGG - Intronic
986819504 5:11449895-11449917 CATTTTATCTAGAAGATCCAGGG - Intronic
987533243 5:19149140-19149162 CAATTATGGCAGAAGATGAAGGG + Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
988798068 5:34670664-34670686 CAAATTGAACAGAAGATGCAAGG - Intronic
988932699 5:36052527-36052549 CAATTTACTCAGATGAAGCATGG - Intronic
994586102 5:101711415-101711437 TAATTTTTGTAGAAGATGTAAGG + Intergenic
995195874 5:109367555-109367577 CTATTTAAGCAACAGATGCAAGG + Intronic
998189209 5:140008174-140008196 GAGTCTATGCAGAAGATGCATGG + Intronic
998620893 5:143793119-143793141 CAATTTAGGCACAAGATACGTGG + Intergenic
999799795 5:155022835-155022857 CAAATCATGCAAAAGATGCTGGG - Intergenic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1001264791 5:170266190-170266212 CAATTTACGCAGAATATTCTTGG - Intronic
1001807856 5:174603875-174603897 TAATTTATGCAGAAAATTCAAGG - Intergenic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1005100324 6:22165989-22166011 CAATAGATGCAGAAAAAGCATGG - Intergenic
1005193035 6:23248962-23248984 CAATTTCTGCAGTAGATGAAGGG + Intergenic
1006200927 6:32289859-32289881 GAAGTTATGGAGAAGATACAGGG + Intronic
1007177530 6:39906983-39907005 CACTTTATGGAAAGGATGCAGGG - Exonic
1008434158 6:51455651-51455673 CATTTTATTCAGAAGAAGTATGG + Intergenic
1010415845 6:75610577-75610599 CAATGGATGCAGAAGATTCTGGG - Intronic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012206947 6:96473245-96473267 TAATTTTTGTAGAAGATGTAAGG + Intergenic
1013629912 6:111976336-111976358 CAAATGCTGCAGAAGATACAAGG - Intergenic
1014288538 6:119531166-119531188 CAATTTTGGCAGAAGGTGAAGGG - Intergenic
1014378769 6:120713038-120713060 GAATTTATCCCAAAGATGCAAGG + Intergenic
1021914283 7:25415738-25415760 CCAGTTATGCAGCAGATGCACGG + Intergenic
1023031911 7:36097066-36097088 CAATTTCTGTGGAAGATGCAGGG - Intergenic
1023088380 7:36594994-36595016 CAAATTGTGCAGGAGTTGCAGGG - Intronic
1023233277 7:38056529-38056551 CAATGTATGCAGGAAAAGCATGG + Intergenic
1023579404 7:41665419-41665441 CAGTATATGCAATAGATGCATGG + Intergenic
1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG + Intronic
1028788765 7:94828520-94828542 CAATTTATTTAGAAGGTACAAGG + Intergenic
1029075718 7:97932365-97932387 CAATTTGTCAAGAAGCTGCACGG + Intergenic
1029678037 7:102085219-102085241 CATATTATGCATAAAATGCATGG - Intronic
1029875494 7:103746241-103746263 TAATTTTTGCATAAGATGTAAGG - Intronic
1030736079 7:113050234-113050256 TAATTTTTGTATAAGATGCAAGG + Intergenic
1031193470 7:118585097-118585119 CAATTATGGCAGAAGATGAAGGG + Intergenic
1032924086 7:136581912-136581934 CAATTATGGCAGAAGATGAAAGG - Intergenic
1033319755 7:140328680-140328702 CAATTTAAGGAGAGGCTGCATGG + Intronic
1033712177 7:143959145-143959167 GAATTTGTGGAGAGGATGCAGGG + Intergenic
1034974017 7:155437473-155437495 CAATTTATGCAGAAATTTCTAGG + Intergenic
1035006679 7:155668344-155668366 CAATTTTTGTTGAAGAAGCAAGG + Intronic
1035104029 7:156427185-156427207 CAATTTGCGGAGAAGATTCATGG - Intergenic
1035441204 7:158902503-158902525 CTATTAATGCAGAAAATGAAAGG + Exonic
1036241806 8:7087967-7087989 CAATTTGTCAAGAAGCTGCACGG - Intergenic
1036260027 8:7232136-7232158 CAATTTGTCAAGAAGCTGCACGG + Intergenic
1036306586 8:7607386-7607408 CAATTTGTCAAGAAGCTGCATGG - Intergenic
1036312068 8:7690705-7690727 CAATTTGTCAAGAAGCTGCACGG + Intergenic
1036357434 8:8055374-8055396 CAATTTGTCAAGAAGCTGCACGG - Intergenic
1036830927 8:12019117-12019139 CAATTTGTCAAGAAGCTGCACGG + Intergenic
1036901066 8:12669555-12669577 CAATTTGTCAAGAAGCTGCACGG + Intergenic
1038105927 8:24433949-24433971 CAATTTATAAATAAGGTGCAGGG + Intergenic
1038931423 8:32197796-32197818 CAAAATATGCAGAAGAGGGAGGG - Intronic
1040320109 8:46288855-46288877 GACTTTTTGCAGAATATGCAAGG - Intergenic
1040368115 8:46741053-46741075 CAATTTTTGTATAAGGTGCAAGG + Intergenic
1040816776 8:51516241-51516263 CAATTTATGTAAAATATGCATGG + Intronic
1042534814 8:69848243-69848265 TAATTTTTGTAGAAGATGTAAGG - Intergenic
1042709729 8:71703645-71703667 CAGTTTATCCAGAAAATGCATGG - Intergenic
1042770314 8:72373444-72373466 CTATTTTCCCAGAAGATGCAAGG + Intergenic
1043954900 8:86348759-86348781 CAAATTATGCAGAACACACAAGG + Intronic
1044043123 8:87395357-87395379 CAAGTTATGGAGAAGAGGGAAGG + Intronic
1044305492 8:90636020-90636042 CAGTTTATGCAGTTTATGCATGG - Intronic
1044677619 8:94745511-94745533 CAATTAAGGAATAAGATGCAAGG + Intronic
1045019474 8:98029225-98029247 CAATCTATCCAGATGATTCAGGG - Intronic
1045717113 8:105060197-105060219 CGATTTATGCATAACATGCAGGG + Intronic
1045950135 8:107842348-107842370 CTTTTTATCCAAAAGATGCAAGG - Intergenic
1048703800 8:137126373-137126395 CAATTTTTGTATAAGGTGCAGGG + Intergenic
1050158753 9:2695279-2695301 CATTTCAAGCAGAAGAGGCAAGG - Intergenic
1050366422 9:4877723-4877745 TTATTTATATAGAAGATGCAAGG + Intronic
1050845885 9:10217787-10217809 CCATTTAGGAAGGAGATGCAAGG + Intronic
1050848256 9:10251759-10251781 CATATTATGGAGAAGTTGCAAGG - Intronic
1051397270 9:16637420-16637442 CCATCTATCCAGAACATGCAGGG + Intronic
1052475237 9:28951215-28951237 TAATTTTTGCAGAAGGTGTAAGG - Intergenic
1052596834 9:30572282-30572304 CAATTTTTGTATAAGATGTAAGG - Intergenic
1052856677 9:33411203-33411225 CAATTTATGCAGAAATTCCTAGG - Intergenic
1055180840 9:73384550-73384572 GAATTTATCCAGGGGATGCAAGG - Intergenic
1055821318 9:80267870-80267892 GAATTTATGAAGAGGATGGATGG - Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1056201254 9:84278904-84278926 CAACTTATACAGTAGTTGCAAGG + Intronic
1056734531 9:89196732-89196754 CAATTTTGGCAGAAGGTGAAGGG + Intergenic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1058248577 9:102662211-102662233 CAATTTTTGCAGAAGATCGGAGG - Intergenic
1060429060 9:123533022-123533044 CATTTTATGTAGGAAATGCAGGG + Intronic
1060577007 9:124705157-124705179 CACTTTATGCAAAATATACAAGG - Intronic
1060655501 9:125369814-125369836 CAATTTCTGGGGAAGATGCCAGG + Intergenic
1060876299 9:127085973-127085995 CAATTAATCCAGAAGGTGCTGGG - Intronic
1203401379 Un_KI270519v1:103740-103762 CACTTTTTGCAGAATCTGCAAGG + Intergenic
1186281800 X:8001114-8001136 CAATTATGGCAGAAGATGAAGGG + Intergenic
1186710738 X:12193577-12193599 CAACTTATGCAGAAGAAGATAGG - Intronic
1187467680 X:19541459-19541481 TAATGTATGAAGAAGATGTAGGG - Intronic
1188162611 X:26821552-26821574 CAATTTAGGCACTGGATGCAGGG + Intergenic
1188555268 X:31404859-31404881 CCATTTATGCAATTGATGCATGG + Intronic
1188715471 X:33455112-33455134 CAATTTTTGTATATGATGCAAGG - Intergenic
1189860070 X:45262910-45262932 GAATTTATGCAGAAGATATCTGG - Intergenic
1191177637 X:57522261-57522283 TAATTTTTGTAGAAGGTGCAGGG + Intergenic
1191899353 X:66024707-66024729 CAATTTATTTAGGAGATTCAAGG - Intronic
1192941244 X:75913714-75913736 CAATTATTGCAGAAGGTGAAGGG + Intergenic
1193257265 X:79364753-79364775 AAGTTAATGCAGAAGATGAAAGG + Intronic
1194393648 X:93352256-93352278 CAATTTAGCCATAAGAAGCATGG + Intergenic
1194655036 X:96562473-96562495 ATAATTATTCAGAAGATGCATGG - Intergenic
1198759782 X:140019217-140019239 CAATTTATGCAGAAATTTCTAGG + Intergenic
1198779003 X:140214833-140214855 CAATTTATGCAGAAATTTCTAGG - Intergenic
1201618901 Y:15933114-15933136 CAATCGTGGCAGAAGATGCAGGG + Intergenic