ID: 1000466370

View in Genome Browser
Species Human (GRCh38)
Location 5:161582743-161582765
Sequence TTGTTGATCACCAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000466370_1000466375 -8 Left 1000466370 5:161582743-161582765 CCCTCTGCCCTGGTGATCAACAA 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1000466375 5:161582758-161582780 ATCAACAAAATCTTATGTGGTGG No data
1000466370_1000466376 26 Left 1000466370 5:161582743-161582765 CCCTCTGCCCTGGTGATCAACAA 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1000466376 5:161582792-161582814 GCAAAAGTTTCTGAGTGAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000466370 Original CRISPR TTGTTGATCACCAGGGCAGA GGG (reversed) Intronic
900236893 1:1597337-1597359 TTGCAGGTGACCAGGGCAGAAGG + Intergenic
900870213 1:5297023-5297045 TTTGTCATCAGCAGGGCAGAAGG - Intergenic
901856176 1:12045518-12045540 TTGTCGGTGACCAGGGCAGAGGG - Intergenic
902719498 1:18294750-18294772 TTGGTGACCACCAAGGGAGAGGG + Intronic
903279955 1:22244798-22244820 TTACTGATAACCAGGGGAGAAGG + Intergenic
904208810 1:28872262-28872284 GTGATGAGCACCAAGGCAGATGG + Intergenic
904367446 1:30023653-30023675 TTGACTGTCACCAGGGCAGAGGG - Intergenic
905274151 1:36806253-36806275 TTGTTCTTCACCAGCGCCGATGG + Exonic
908944632 1:69479503-69479525 TTGTTACTCACCAGAGTAGAGGG - Intergenic
910791609 1:91056623-91056645 TTGTGGGTCACCAGGGGTGATGG + Intergenic
911738197 1:101360417-101360439 TAGTTGATCACTAGGGGTGATGG + Intergenic
911883779 1:103271981-103272003 TAGTTGATCACTAGGGATGATGG - Intergenic
913576472 1:120180373-120180395 TGTTTAATCACCAGTGCAGATGG - Intergenic
914558378 1:148791811-148791833 TGTTTAATCACCAGTGCAGATGG - Intergenic
914614457 1:149338419-149338441 TGTTTAATCACCAGTGCAGATGG + Intergenic
916831256 1:168493635-168493657 TTGTGGAACACCAGTGCACATGG + Intergenic
921154413 1:212427738-212427760 TTTGTCATCACCAGGGCAGTGGG - Intergenic
924245639 1:242081424-242081446 TTGCTGGTCACCATGCCAGAGGG - Intergenic
924304092 1:242669324-242669346 TTGTAGGTCTCCAGGACAGATGG - Intergenic
1064427540 10:15243420-15243442 TTTTTGATGTCCATGGCAGATGG - Intronic
1064806340 10:19138122-19138144 CTGTTGATGAACATGGCAGAAGG - Intronic
1067570657 10:47368768-47368790 CTGGTGATCACCATGGCAGCTGG - Exonic
1070532211 10:77346906-77346928 TTCTTGGTCAGCAGGGCAGTCGG - Intronic
1073435208 10:103512146-103512168 CTGCTGATCACTTGGGCAGAGGG + Intronic
1073492740 10:103865169-103865191 GTGTTTAACTCCAGGGCAGAAGG + Intergenic
1073855900 10:107672920-107672942 TGCTTTATCACAAGGGCAGAAGG - Intergenic
1075065908 10:119288716-119288738 TGGTTGATTCCCAGGGCAGCAGG + Intronic
1079460315 11:20672750-20672772 GTTTTGGTCACCAGGGCAGAGGG + Intronic
1085686171 11:78623680-78623702 TTGTGGATCACTAGGGGTGATGG - Intergenic
1086499905 11:87441903-87441925 TTGTTGGTAAACATGGCAGAAGG + Intergenic
1088191472 11:107233195-107233217 TAGTGGATCACCAGGGGTGATGG + Intergenic
1091609129 12:1988293-1988315 TTGCTGGTCATCATGGCAGAAGG + Intronic
1092033108 12:5306344-5306366 TTGGTCAGCACCTGGGCAGACGG + Intergenic
1092903283 12:13079860-13079882 TTGCTGACCACCAGGGCTGCTGG - Exonic
1093563864 12:20578387-20578409 TTATTAATCACCGTGGCAGAAGG + Intronic
1095253233 12:40003050-40003072 TTATTATTCACCAGGGGAGAGGG - Intronic
1101193468 12:102358774-102358796 TTGTTGGTCACCATGGCTGGAGG - Intergenic
1103301397 12:119930260-119930282 ATGTTAATCAGGAGGGCAGATGG - Intergenic
1104760409 12:131294869-131294891 TTGTTGCTCACCTGCGAAGAGGG + Intergenic
1105827374 13:24134410-24134432 TTGTTTATCACAGAGGCAGATGG + Intronic
1107276911 13:38688395-38688417 TTGAAGATCAACAGGTCAGAGGG - Exonic
1108385710 13:49897576-49897598 TTGTTGGTCTCCAGGGAAGAGGG - Intergenic
1109189116 13:59304564-59304586 AGGTTGAAAACCAGGGCAGAAGG - Intergenic
1111036211 13:82677533-82677555 ATGTTGATCACCAGGACAATGGG - Intergenic
1113577082 13:111402463-111402485 TTGGTGTACACCAGGGAAGATGG + Intergenic
1116625152 14:47254182-47254204 ATGTTGATCACCAAGACAGTGGG - Intronic
1117396811 14:55319027-55319049 TTGTTGATGGCCAGTGTAGAAGG + Intronic
1119584880 14:75823872-75823894 TTGTTGAATAAGAGGGCAGAAGG - Intronic
1119730874 14:76950481-76950503 TGGCTGTTCACCAGAGCAGAGGG + Intergenic
1121534188 14:94679957-94679979 TTGCTGATTACCATTGCAGAGGG + Intergenic
1121863533 14:97341280-97341302 TTGTTGGTCACCAGGGCTGTTGG + Intergenic
1124000524 15:25755668-25755690 ATGTTAACCACCAGGACAGATGG + Intronic
1126480290 15:49111141-49111163 TTGTTGAGCTCCTGGGCAGTGGG - Intronic
1126996662 15:54452374-54452396 ATGTTCAACACCAGTGCAGATGG - Intronic
1129097755 15:73226324-73226346 CTTTGGATCACCATGGCAGACGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129678783 15:77646393-77646415 GTCTTGATCACCATGACAGAGGG - Intronic
1130955136 15:88622075-88622097 TGGCTGATCAAGAGGGCAGAGGG - Intronic
1133536681 16:6709032-6709054 TTATTGCTCACCTGGGGAGATGG - Intronic
1133623088 16:7545128-7545150 TTGATGCTCAGCAAGGCAGAGGG - Intronic
1133824624 16:9267023-9267045 TTGTTGAGCACCAGCCCTGAGGG - Intergenic
1134670074 16:16048136-16048158 TTGGTGATCACCAGGGCCTGTGG - Exonic
1137853844 16:51773508-51773530 TTCTTTATCACAAGGACAGAGGG - Intergenic
1151268016 17:72971565-72971587 CTGTTGATCACAAGTGCTGATGG - Intronic
1153080494 18:1218049-1218071 TTGTTGCTCCCCATGTCAGAGGG - Intergenic
1153146656 18:2040321-2040343 TTGCTGGTCTCCACGGCAGAGGG - Intergenic
1154252353 18:12755268-12755290 TAGTGGATCACCAGGGGTGATGG + Intergenic
1155735932 18:29222236-29222258 TTGCTGATCCACATGGCAGAAGG - Intergenic
1155836644 18:30593905-30593927 TTGTGGAAAACCAGAGCAGATGG - Intergenic
1157091393 18:44641086-44641108 TTGTCGGTCACCAGACCAGAAGG + Intergenic
1158059434 18:53320512-53320534 TTGTTGATTACAGAGGCAGAGGG - Intronic
1158829609 18:61263295-61263317 TTTTGGATCATCATGGCAGATGG + Intergenic
1160349135 18:78159613-78159635 GTGGTGATCACCAGGGCTGGGGG - Intergenic
1162636900 19:11975931-11975953 ATGCTGATAACAAGGGCAGATGG - Intronic
1168310361 19:55456881-55456903 TGGATGGTAACCAGGGCAGATGG - Intronic
933557297 2:83847070-83847092 TTGTTGAACACCTGGGCAGGAGG - Intergenic
934906896 2:98213138-98213160 CTGTTGATGTCCTGGGCAGAAGG + Intronic
935199747 2:100845879-100845901 TGGTTCCTCACCATGGCAGAGGG + Intronic
937516917 2:122665657-122665679 TTGTCGAGCACATGGGCAGACGG - Intergenic
939506962 2:143057287-143057309 ATGTTGATCACCAGGACCAAAGG - Intergenic
943006599 2:182393466-182393488 ATGTTAATCACCAAGGCAGTGGG - Intronic
943119875 2:183722579-183722601 TTAGTGGTTACCAGGGCAGAAGG + Intergenic
947617456 2:231567611-231567633 TTGTGAATCACCAGGGGAGTGGG - Intergenic
1172949453 20:38713385-38713407 TTGCTGAGCACCAGGATAGAAGG + Intergenic
1173679714 20:44869295-44869317 TTTTTTAACCCCAGGGCAGAAGG - Intergenic
1175561092 20:59932288-59932310 ATGTTAGTTACCAGGGCAGAGGG - Intronic
1175898003 20:62347970-62347992 TTGTTGATCACCTGTGCTGACGG - Intronic
1178037456 21:28600578-28600600 ATGTTAATCACCAGGACAGTGGG - Intergenic
1179354152 21:40642889-40642911 ATGAGAATCACCAGGGCAGAGGG + Intronic
1179791748 21:43759869-43759891 ATGCTGATCACCAGGGCCGAGGG + Exonic
1183253905 22:36748344-36748366 TTGCTGATCTCAGGGGCAGAAGG - Intergenic
1183599433 22:38831435-38831457 TTGTTCATTCCCAGGACAGATGG + Intronic
1184893855 22:47395732-47395754 TCATTAATCACCAGGGGAGAGGG - Intergenic
1184901332 22:47448340-47448362 TTGAGGACCACCAGAGCAGAGGG + Intergenic
956883695 3:73537000-73537022 CTGTTGAGGACCAGGGCAGAAGG - Intronic
959592938 3:108099276-108099298 TTGCTGATTGCCATGGCAGAAGG - Intergenic
961009223 3:123424808-123424830 TTATTGCTCCCCAGGACAGATGG - Intronic
970354463 4:15238223-15238245 TTGTTTTTCATCAGGGGAGAAGG + Intergenic
971236076 4:24843650-24843672 GTGTTGATCTCCAGGGTAGGAGG - Intronic
971449151 4:26783994-26784016 TTGTTGGTCACCAGGGAACCAGG + Intergenic
971599791 4:28577532-28577554 TTGGTGATCACCAGTGAAAAAGG + Intergenic
972917882 4:43903500-43903522 TTTTTTATCACAAGGACAGAGGG - Intergenic
973892253 4:55378802-55378824 TTATTGCTCACCAGAGCAAAGGG - Intergenic
974289758 4:59914224-59914246 TTGTGGATCACTAGGGGTGATGG - Intergenic
975923144 4:79417168-79417190 TTGTTGAAAACTAAGGCAGATGG + Intergenic
976672979 4:87674228-87674250 ATGTTAATCACCAGGGCAATGGG - Intergenic
979740414 4:124143206-124143228 TTGTTAATCACCAGGACAACGGG + Intergenic
985091836 4:186371203-186371225 TTGCTGGTCACCATGTCAGAAGG + Intergenic
985109397 4:186533717-186533739 TTGTTGGTCATCAGTGGAGACGG + Exonic
985361214 4:189177933-189177955 GCTTTGATCACCAGGGCACATGG + Intergenic
986526966 5:8689153-8689175 TTGTGGATCAACGTGGCAGAAGG + Intergenic
987578142 5:19756820-19756842 TAGTGGATCACTAGGGGAGATGG + Intronic
990783047 5:59387958-59387980 TGGTTGTTAACCAGGGCTGATGG - Intronic
993127169 5:83849964-83849986 ATATTGATAACCTGGGCAGATGG + Intergenic
996060538 5:119028488-119028510 CTGTTGATAACTCGGGCAGACGG + Intergenic
996821283 5:127631402-127631424 TTGTTAATCACCAGTGCAAAGGG + Intergenic
1000466370 5:161582743-161582765 TTGTTGATCACCAGGGCAGAGGG - Intronic
1000701850 5:164461246-164461268 TTGTTGCTCCGCTGGGCAGAAGG + Intergenic
1003385222 6:5661160-5661182 TAGTTGAACACGAGGGAAGAGGG + Intronic
1006625199 6:35392766-35392788 TGGTGGGTCACCAGAGCAGAAGG - Intronic
1007807034 6:44458129-44458151 TTGTTGTTCTAAAGGGCAGATGG + Intergenic
1009851681 6:69207252-69207274 TAGTGGATCACTAGGGGAGATGG + Intronic
1010076518 6:71804205-71804227 TTGTGGATCATCATGGCAGATGG - Intergenic
1010516342 6:76776239-76776261 ATGTTGAGCAACAGGGCAGTTGG + Intergenic
1013457987 6:110349344-110349366 TTGCTGGTCACCTTGGCAGAGGG - Intronic
1013988068 6:116220364-116220386 TGGCTGAGCTCCAGGGCAGATGG - Intronic
1015186300 6:130420417-130420439 TTGTTGGTCACCATGGCAAGGGG + Intronic
1015381041 6:132569538-132569560 TTGTTGGTAACCAATGCAGATGG + Intergenic
1015464145 6:133529136-133529158 TTGTTGACCACCTTGTCAGACGG - Exonic
1015823342 6:137285696-137285718 TTATAGAACACCAGTGCAGATGG - Intergenic
1018370843 6:163166254-163166276 TTGTTGTTGAGCAGGGCAAATGG - Intronic
1023569096 7:41553968-41553990 TTTGTCATCACCATGGCAGAGGG + Intergenic
1023684000 7:42716836-42716858 GTCTTGATCACCATGGCAGTGGG - Intergenic
1024759266 7:52575088-52575110 TCATTCTTCACCAGGGCAGAGGG - Intergenic
1030521641 7:110605037-110605059 TTGCTGATCACCAGGGAAGGTGG + Intergenic
1032628511 7:133620939-133620961 TGGTTGATCAACAAGGCACAAGG - Intronic
1033642147 7:143271564-143271586 TTATTGATCAGAAGGGAAGAGGG - Intergenic
1033710625 7:143939275-143939297 TTCTTGATCACTAGAGCAGAAGG - Intergenic
1034261807 7:149761550-149761572 TTGTGGATCGCCCGGGGAGAAGG - Intergenic
1034284028 7:149873031-149873053 TTTTTGATCGCCAGAGAAGAAGG + Exonic
1034353976 7:150435992-150436014 TTGTTGATCTCTAGGTCAGCTGG - Intergenic
1036644570 8:10603677-10603699 TTCTTTATCTCCAGGTCAGAAGG + Intergenic
1037364383 8:18106772-18106794 TAGTGGATCACCAGGGGTGATGG + Intergenic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1046863339 8:119118874-119118896 TTGCTGATCACCAGGGCAATGGG - Intergenic
1047214286 8:122864173-122864195 TTCTAGATCACCAGGGAACAGGG - Intronic
1047373401 8:124274695-124274717 TTATTGCTCTCCAGGGCAGGAGG - Intergenic
1048258623 8:132925718-132925740 ATGGTGATCACCAGGGCCGCAGG - Intronic
1050095391 9:2059717-2059739 TTGCTCATCCACAGGGCAGACGG + Intronic
1051984301 9:23063972-23063994 ATGTTAATCACCAGGACAAATGG - Intergenic
1054971175 9:71089022-71089044 TAGCTGCTCTCCAGGGCAGAAGG + Intronic
1189039874 X:37530906-37530928 TTTTGGATCACCAGGCAAGATGG - Intronic
1189482802 X:41406103-41406125 TCTTTGATAAGCAGGGCAGATGG - Intergenic
1191615845 X:63168633-63168655 TCCTTGGTCACAAGGGCAGAGGG - Intergenic
1191620453 X:63210290-63210312 TCCTTGGTCACAAGGGCAGAGGG + Intergenic
1192893654 X:75417175-75417197 GTGTCCATCACCAGGGCTGATGG + Exonic
1194457154 X:94118965-94118987 TAGTGGATCACCAGGGGCGATGG - Intergenic
1196033810 X:111121355-111121377 TTGTCAATCACCTGTGCAGATGG + Intronic
1196573047 X:117285614-117285636 TTGTTTATTATCATGGCAGAGGG + Intergenic
1196819373 X:119690867-119690889 TTGTAATTCACCAGGGAAGACGG - Intronic
1197074240 X:122336387-122336409 TAGTGGATCACTAGGGAAGATGG + Intergenic
1197124367 X:122926608-122926630 TTGCTTATCCCCAGGGTAGAGGG - Intergenic
1197593675 X:128441153-128441175 TTGCTGGTCAGCTGGGCAGAGGG + Intergenic
1199144258 X:144347487-144347509 TAGTGGATCACTAGGGGAGATGG + Intergenic
1199284206 X:146038443-146038465 ATGTTAATCCCCAGGGCAGTGGG + Intergenic