ID: 1000469827

View in Genome Browser
Species Human (GRCh38)
Location 5:161627553-161627575
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8715
Summary {0: 1, 1: 5, 2: 62, 3: 1062, 4: 7585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000469827 Original CRISPR ATGGAGGAAGGGAATGAGGA CGG (reversed) Intronic
Too many off-targets to display for this crispr