ID: 1000470988

View in Genome Browser
Species Human (GRCh38)
Location 5:161641654-161641676
Sequence GATTTGGTCATAGAACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000470986_1000470988 3 Left 1000470986 5:161641628-161641650 CCATCACTCTACAGACACGCAGT 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
1000470985_1000470988 4 Left 1000470985 5:161641627-161641649 CCCATCACTCTACAGACACGCAG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
1000470983_1000470988 25 Left 1000470983 5:161641606-161641628 CCTACTCATGTATCACCATCACC No data
Right 1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
1000470984_1000470988 10 Left 1000470984 5:161641621-161641643 CCATCACCCATCACTCTACAGAC 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG 0: 1
1: 0
2: 1
3: 3
4: 85
1000470982_1000470988 28 Left 1000470982 5:161641603-161641625 CCTCCTACTCATGTATCACCATC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1000470988 5:161641654-161641676 GATTTGGTCATAGAACACCCTGG 0: 1
1: 0
2: 1
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000470988 Original CRISPR GATTTGGTCATAGAACACCC TGG Intronic