ID: 1000472575

View in Genome Browser
Species Human (GRCh38)
Location 5:161663845-161663867
Sequence GAGGTACAGCATGAGGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1060
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 1018}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000472569_1000472575 12 Left 1000472569 5:161663810-161663832 CCTGACCTGATAAAACTATCCAA 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG 0: 1
1: 0
2: 4
3: 37
4: 1018
1000472570_1000472575 7 Left 1000472570 5:161663815-161663837 CCTGATAAAACTATCCAAATTTG 0: 1
1: 0
2: 0
3: 18
4: 298
Right 1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG 0: 1
1: 0
2: 4
3: 37
4: 1018
1000472573_1000472575 -7 Left 1000472573 5:161663829-161663851 CCAAATTTGGAATTTTGAGGTAC 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG 0: 1
1: 0
2: 4
3: 37
4: 1018
1000472568_1000472575 18 Left 1000472568 5:161663804-161663826 CCATTTCCTGACCTGATAAAACT 0: 1
1: 0
2: 0
3: 22
4: 243
Right 1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG 0: 1
1: 0
2: 4
3: 37
4: 1018

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000472575 Original CRISPR GAGGTACAGCATGAGGTGTT AGG Intronic
900918387 1:5654551-5654573 GAGTGAGAACATGAGGTGTTTGG - Intergenic
901545351 1:9952481-9952503 GAGGAACAGCATCAGTTTTTAGG + Intronic
902100857 1:13987404-13987426 GAGTGACAACATGTGGTGTTTGG + Intergenic
903815392 1:26060852-26060874 GAGGCACAGGAAGAGGTGTCTGG + Intronic
904663086 1:32099642-32099664 GAGAAACAGCATGAGCTGTGTGG + Intronic
905700306 1:40007990-40008012 GAGTGAGAACATGAGGTGTTTGG - Intergenic
906035871 1:42750139-42750161 GAGGTACAGCATGCGGGGGCGGG + Intronic
906187344 1:43871752-43871774 GAGGGAGAGGATGAGGTGTGAGG + Intronic
906752077 1:48273574-48273596 GAGTGAGAACATGAGGTGTTTGG + Intergenic
906770205 1:48476675-48476697 GAGTGACAACATGCGGTGTTTGG - Intergenic
906826140 1:48982428-48982450 GAGTGAGAACATGAGGTGTTTGG + Intronic
906834496 1:49068463-49068485 GAGTGAGAACATGAGGTGTTTGG + Intronic
906842708 1:49157315-49157337 GAGTGAGAACATGAGGTGTTTGG + Intronic
908778435 1:67665407-67665429 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
908879835 1:68718777-68718799 GAGTAAGAACATGAGGTGTTTGG + Intergenic
909816813 1:80004579-80004601 GAGTGAGAACATGAGGTGTTTGG + Intergenic
910222771 1:84905053-84905075 GAGTGAGAACATGAGGTGTTTGG - Intergenic
910537221 1:88312135-88312157 GCAGTACAGCATGAGTTGTTAGG + Intergenic
910954602 1:92688291-92688313 GAGTGAGAGCATGCGGTGTTTGG - Intronic
910991373 1:93059786-93059808 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
911243287 1:95488975-95488997 GAGGGAGAACATGTGGTGTTTGG - Intergenic
911849883 1:102804619-102804641 GAGTGAGAACATGAGGTGTTAGG + Intergenic
912083297 1:105966832-105966854 GAGTGAGAACATGAGGTGTTTGG - Intergenic
912527476 1:110294501-110294523 GAGGGACAGCATCAGGTAGTGGG + Intergenic
912688713 1:111787382-111787404 GAGGTGCTGCATCAGGTGGTGGG + Intronic
912969740 1:114269665-114269687 CAGGTACCGCTTTAGGTGTTGGG - Intergenic
913033660 1:114938306-114938328 GAGTGAGAACATGAGGTGTTTGG - Intronic
913084070 1:115418964-115418986 GAGTGACAACATGTGGTGTTTGG - Intergenic
913258858 1:116980613-116980635 GAGTGAGAACATGAGGTGTTTGG - Intronic
913399162 1:118409056-118409078 GAGTGACAACATGTGGTGTTTGG - Intergenic
913473380 1:119213335-119213357 GAGTGAGAACATGAGGTGTTTGG - Intergenic
913493000 1:119399573-119399595 GAGTGAGAACATGAGGTGTTTGG + Intergenic
914440899 1:147705224-147705246 GAGTGAGAACATGAGGTGTTTGG + Intergenic
914682921 1:149952282-149952304 GAGGGAGAACATGTGGTGTTTGG + Intronic
915026554 1:152836123-152836145 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
915031473 1:152883528-152883550 GAAGTAAAGCAAGAGTTGTTTGG + Intronic
915678819 1:157559384-157559406 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
915807551 1:158870562-158870584 GAGTGAGAACATGAGGTGTTTGG - Intergenic
916013942 1:160731649-160731671 GAGTGAGAACATGAGGTGTTTGG + Intergenic
916314373 1:163432151-163432173 GAGTGAGAGCATGAGGTGTTTGG + Intergenic
916593000 1:166211462-166211484 GAGTGAGAACATGAGGTGTTTGG + Intergenic
916621552 1:166503552-166503574 GAGTGAGAACATGAGGTGTTTGG - Intergenic
916857892 1:168770172-168770194 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
917111264 1:171550700-171550722 GAGTGAGAACATGAGGTGTTTGG + Intronic
917331091 1:173881187-173881209 GAGTGAGAACATGAGGTGTTTGG + Intronic
917454634 1:175175784-175175806 GAGTGAGAACATGAGGTGTTTGG - Intronic
918085631 1:181242652-181242674 GAGTGAGAACATGAGGTGTTTGG + Intergenic
918098477 1:181353528-181353550 GAGAGAGAGCATGATGTGTTTGG + Intergenic
918477246 1:184938014-184938036 GAGGCAAAGGATGAGGTGATTGG + Intronic
918510301 1:185305567-185305589 GATGGACAGGCTGAGGTGTTTGG - Exonic
918565973 1:185932627-185932649 GAGTGAAAACATGAGGTGTTTGG - Intronic
918616066 1:186545530-186545552 GAGGGAGAACATGCGGTGTTTGG + Intergenic
918655791 1:187024604-187024626 GAGTGACAACATGAGGTCTTTGG - Intergenic
919031503 1:192249203-192249225 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
919474324 1:198016227-198016249 GAGTGAGAACATGAGGTGTTTGG + Intergenic
919737233 1:200960297-200960319 GAGGCTCAGCATGAGGAGCTGGG - Intergenic
920240659 1:204546628-204546650 GAAGTACAGAATCATGTGTTTGG + Intronic
920435156 1:205942608-205942630 GAGCTGCAGGATGAGGGGTTTGG + Intronic
920669804 1:207994881-207994903 GAGTTAGAACATGCGGTGTTTGG - Intergenic
921296322 1:213706781-213706803 GAGTGAGAACATGAGGTGTTTGG + Intergenic
921406563 1:214786199-214786221 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
921415400 1:214880519-214880541 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
921497341 1:215857783-215857805 GAGGGGCAGCATCAGGTGGTTGG + Intronic
921543467 1:216447438-216447460 GAGGGAGAACATGTGGTGTTTGG - Intergenic
921615212 1:217258527-217258549 GAGTTAGAACATGCGGTGTTTGG - Intergenic
922545072 1:226450593-226450615 GAGGGGCAGCATCAGGTGGTTGG - Intergenic
923269693 1:232344462-232344484 GAGTAAGAGCATGTGGTGTTTGG - Intergenic
924193849 1:241584212-241584234 GAGTGAGAACATGAGGTGTTTGG + Intronic
1063274041 10:4544694-4544716 GAGTGACAACATGCGGTGTTTGG - Intergenic
1063567381 10:7182625-7182647 GAGTGAGAACATGAGGTGTTTGG - Intronic
1064572504 10:16709228-16709250 GAGTGAGAACATGAGGTGTTTGG + Intronic
1064883088 10:20079691-20079713 GAGTGACAACATGTGGTGTTTGG - Intronic
1064891753 10:20182929-20182951 GAGTGAGAACATGAGGTGTTTGG + Intronic
1064916059 10:20459912-20459934 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1065553474 10:26891706-26891728 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1066525683 10:36276657-36276679 GAGTGACAACATGCGGTGTTTGG - Intergenic
1067210066 10:44252709-44252731 GAGTAAGAGCATGTGGTGTTTGG + Intergenic
1067330886 10:45317795-45317817 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1068111555 10:52686521-52686543 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1068159178 10:53241601-53241623 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1068238669 10:54274043-54274065 GAGTTAGAGCATGCAGTGTTTGG - Intronic
1068308998 10:55255185-55255207 GAGTTAGAACATGCGGTGTTTGG + Intronic
1068498569 10:57816356-57816378 AAAGTACAGCAGCAGGTGTTGGG - Intergenic
1068591517 10:58857406-58857428 AAGTTCCAGCAGGAGGTGTTGGG + Intergenic
1068611426 10:59064675-59064697 GAGGTACAGGTTGGGGTGTAGGG - Intergenic
1069049569 10:63778286-63778308 GAGTGACAACATGTGGTGTTTGG + Intergenic
1069066249 10:63944870-63944892 GAGTTAGAACATGCGGTGTTTGG + Intergenic
1069321989 10:67183447-67183469 GAGTGAGAGCATGCGGTGTTTGG - Intronic
1069331073 10:67293749-67293771 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1069596071 10:69671638-69671660 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1070622856 10:78027318-78027340 GAGCTAAAGCATGAGGGCTTGGG + Intronic
1070931977 10:80267104-80267126 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1071093973 10:81952030-81952052 GAGGGAGAACATGCGGTGTTTGG - Intronic
1071350189 10:84732978-84733000 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1071605520 10:86984581-86984603 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1072393021 10:95008373-95008395 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1072561067 10:96574831-96574853 GAGTGAGAACATGAGGTGTTTGG - Intronic
1073936920 10:108643527-108643549 GAGTGACAACATGAGTTGTTTGG + Intergenic
1074023782 10:109612657-109612679 GAGTGACAACATGCGGTGTTTGG + Intergenic
1075489951 10:122858311-122858333 GAGTGAGAACATGAGGTGTTTGG - Intronic
1076003143 10:126928222-126928244 GAGGAACAGCATGAGCTCGTGGG + Intronic
1076089403 10:127668603-127668625 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1076097833 10:127746881-127746903 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1076934777 10:133560048-133560070 GAGGCACAGCCTGAGGTTTGGGG - Intronic
1077791981 11:5450802-5450824 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1078074922 11:8149865-8149887 GAGGGACAGTATCAGGTGGTTGG - Intronic
1078122199 11:8522382-8522404 GAGGGAGAACATGCGGTGTTTGG - Intronic
1078309546 11:10226562-10226584 GAGTGAGAACATGAGGTGTTTGG + Intronic
1078636856 11:13059250-13059272 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1078747952 11:14133301-14133323 TAGGCACAGCACTAGGTGTTGGG + Intronic
1078794224 11:14575492-14575514 GAGTTAGAACATGCGGTGTTTGG + Intronic
1078972282 11:16427562-16427584 GAGTGAGAACATGAGGTGTTTGG + Intronic
1078982298 11:16550224-16550246 GAGTTAGAACATGGGGTGTTTGG - Intronic
1079552414 11:21715942-21715964 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1079699221 11:23521999-23522021 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1079831478 11:25274870-25274892 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1079859983 11:25656816-25656838 GAGTGACAACATGCGGTGTTTGG + Intergenic
1079867051 11:25749375-25749397 GAGTGACAACATGCGGTGTTTGG - Intergenic
1079872295 11:25814813-25814835 GAGTGACAACATGAGGTGTTTGG + Intergenic
1080465338 11:32490991-32491013 GAGTGACAACATGTGGTGTTTGG + Intergenic
1080733124 11:34981233-34981255 GAGTGACAACATGCGGTGTTTGG + Intronic
1080894381 11:36437049-36437071 GAGGCGCAGCATTAGGTGTGGGG - Intronic
1081179027 11:39965224-39965246 GAGGAGCAGCATCAGGTGGTTGG - Intergenic
1081317229 11:41645312-41645334 GAGTGACAACATGCGGTGTTTGG + Intergenic
1081325957 11:41744658-41744680 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1081364873 11:42222406-42222428 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1081511946 11:43783653-43783675 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1082126027 11:48432089-48432111 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1082138353 11:48576963-48576985 GAGTAACAACATGCGGTGTTTGG - Intergenic
1082180716 11:49115711-49115733 GATGTACATCATCTGGTGTTTGG + Intergenic
1082266938 11:50129410-50129432 GAGATACTGCATGTGGTGTCAGG + Intergenic
1082289151 11:50349158-50349180 GAGATACTGCATGTGGTGTCAGG - Intergenic
1082300558 11:50499670-50499692 GAGTTAGAACATGCGGTGTTTGG - Intergenic
1082753406 11:57047035-57047057 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1083176099 11:60951372-60951394 GAGGTACAGCACGAGGTTGGCGG + Exonic
1083383844 11:62292582-62292604 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1083518337 11:63282443-63282465 GAGGGAGAACATGCGGTGTTTGG + Intronic
1083677787 11:64336637-64336659 GAGGGACAACATGCGGTGTTTGG + Intergenic
1085960551 11:81456663-81456685 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1085968940 11:81563756-81563778 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1086030250 11:82346038-82346060 GAGTTAGAACATGTGGTGTTTGG - Intergenic
1086762532 11:90650676-90650698 AAGATACAGCATGCGGTCTTTGG - Intergenic
1086792548 11:91060820-91060842 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1086793671 11:91073071-91073093 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1086801883 11:91185877-91185899 GCTGTACAGCAGGAGGTGTGCGG - Intergenic
1086832452 11:91582849-91582871 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1087502300 11:98973013-98973035 AAGTGACAGCATGTGGTGTTTGG + Intergenic
1087711606 11:101559867-101559889 GAGGGAGAACATGTGGTGTTTGG + Intronic
1087830455 11:102814112-102814134 GAATGAGAGCATGAGGTGTTTGG + Intergenic
1088035119 11:105302166-105302188 GTGGCAAAGCATGAGGTGTGTGG - Intergenic
1088110971 11:106260955-106260977 GTGGTACAGCAGGAGGTGAGAGG - Intergenic
1088310052 11:108450532-108450554 GAGTGACAACATGTGGTGTTTGG - Intronic
1088750782 11:112840627-112840649 GAGTGACAACATGCGGTGTTTGG + Intergenic
1089043281 11:115474606-115474628 GAGTGAGAGCATGCGGTGTTTGG - Intronic
1089147304 11:116338769-116338791 GAGTTAGAACATGTGGTGTTTGG - Intergenic
1089348231 11:117805601-117805623 GTGCTACAGTATGAGGTTTTGGG + Intronic
1090559701 11:127918607-127918629 GAGTGAAAGCATGTGGTGTTTGG - Intergenic
1091247152 11:134107240-134107262 GAGTGACAACATGCGGTGTTTGG - Intronic
1091562400 12:1625048-1625070 GAGGATCAGAATGAGGTCTTGGG + Intronic
1091854729 12:3730312-3730334 GAGGGTCAGCAAGAGGTGGTGGG + Intronic
1092284400 12:7120544-7120566 TAGGTACAGCAGGAGGTGAAGGG - Intergenic
1092577338 12:9801080-9801102 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1092715289 12:11383064-11383086 GAGTGAGAACATGAGGTGTTTGG - Intronic
1092718987 12:11421892-11421914 GAGTGAGAACATGAGGTGTTTGG - Intronic
1093106724 12:15095915-15095937 GAGTGACAACATGCGGTGTTTGG + Intergenic
1093361526 12:18235077-18235099 GAGTGAGAACATGAGGTGTTTGG + Intronic
1093839324 12:23876902-23876924 GAGTGAGAACATGAGGTGTTTGG - Intronic
1094304384 12:29001178-29001200 GAGTCAGAGCATGTGGTGTTTGG + Intergenic
1094402208 12:30074348-30074370 GAGGAAGAACATGTGGTGTTTGG + Intergenic
1095067255 12:37792802-37792824 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1095072364 12:37868859-37868881 GAGTGACAACATGCGGTGTTTGG - Intergenic
1095104296 12:38213080-38213102 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1096029387 12:48398483-48398505 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1096848690 12:54421502-54421524 GAGGAAAGGCAGGAGGTGTTGGG - Intergenic
1096934041 12:55249988-55250010 GAGTGACAACATGCGGTGTTTGG + Intergenic
1097356199 12:58604967-58604989 GAGTGAGAACATGAGGTGTTTGG - Intronic
1097499238 12:60381212-60381234 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1097556598 12:61146639-61146661 GAGTGAGAACATGAGGTGTTCGG + Intergenic
1097557224 12:61154163-61154185 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1097570185 12:61322606-61322628 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1097624375 12:61982197-61982219 GAGTGAGAACATGAGGTGTTTGG - Intronic
1097741351 12:63246283-63246305 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1098022252 12:66168643-66168665 GAGGTACAGAAAGAGTTGATTGG - Intronic
1098073973 12:66706774-66706796 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1098084369 12:66826210-66826232 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1098151328 12:67549947-67549969 GAGTGACAACATGCGGTGTTTGG + Intergenic
1098671869 12:73241055-73241077 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1098755023 12:74351661-74351683 GAGTGACAACATGTGGTGTTTGG + Intergenic
1098804146 12:75001585-75001607 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1098839469 12:75461371-75461393 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1099385999 12:82014179-82014201 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1099404529 12:82244256-82244278 GAGGGAGAACATGCGGTGTTTGG + Intronic
1099515800 12:83595453-83595475 GAGTAAGAACATGAGGTGTTTGG - Intergenic
1100317222 12:93455349-93455371 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1100923454 12:99516497-99516519 GAGTGACAACATGAGGTGTTTGG - Intronic
1101057448 12:100933352-100933374 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1101753225 12:107600600-107600622 AAGGTGCAGACTGAGGTGTTTGG - Intronic
1103180090 12:118903198-118903220 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1103271831 12:119679958-119679980 GTGGTTCAGCATGACGTGATTGG - Exonic
1103743503 12:123107047-123107069 GGGGTACAGCATGGGGAGGTGGG + Intronic
1105245433 13:18645877-18645899 GAGGTCCAGCCTTAGGTATTTGG + Intergenic
1106524033 13:30524096-30524118 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1108170860 13:47740642-47740664 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1108170937 13:47741368-47741390 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1108199038 13:48024695-48024717 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1108248446 13:48541154-48541176 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1108624511 13:52214023-52214045 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1109359078 13:61272328-61272350 GAGTGACAACATGCGGTGTTTGG - Intergenic
1109565810 13:64115125-64115147 GAGAGAGAACATGAGGTGTTTGG + Intergenic
1109577122 13:64273813-64273835 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1109640986 13:65191434-65191456 GAGGGAGAACATGGGGTGTTTGG + Intergenic
1109641066 13:65192334-65192356 GAGGTAGAACATGCTGTGTTTGG - Intergenic
1109669953 13:65591076-65591098 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1109735648 13:66481062-66481084 GAGTCAGAACATGAGGTGTTTGG - Intronic
1109943015 13:69396100-69396122 GAGTGACAACATGTGGTGTTTGG + Intergenic
1109964405 13:69672718-69672740 GAGTGACAACATGCGGTGTTTGG - Intergenic
1110000567 13:70193999-70194021 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1110018775 13:70442283-70442305 GAGTAACAACATGTGGTGTTTGG - Intergenic
1110243422 13:73294021-73294043 GGGGTACAGCATGGGGAGTCTGG - Intergenic
1111234395 13:85389947-85389969 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1111277663 13:85972009-85972031 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1111640351 13:90961829-90961851 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1111702730 13:91711363-91711385 GAGTGAGAACATGAGGTGTTTGG - Intronic
1112087902 13:96051240-96051262 GAGTGAGAACATGAGGTGTTTGG - Intronic
1112097003 13:96144880-96144902 GAGTGAGAACATGAGGTGTTTGG + Intronic
1112182521 13:97098322-97098344 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1112356037 13:98675613-98675635 GTGGTATAGTAGGAGGTGTTGGG - Intergenic
1112363355 13:98737251-98737273 GAGTGAGAACATGAGGTGTTTGG - Intronic
1112978210 13:105347529-105347551 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1112993695 13:105545963-105545985 GAGGCACAGACTGAAGTGTTTGG - Intergenic
1113245606 13:108391346-108391368 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1113270639 13:108669831-108669853 GAGTGACAACATGTGGTGTTTGG - Intronic
1113288470 13:108879594-108879616 GAGTGAGAACATGAGGTGTTTGG + Intronic
1113483490 13:110638346-110638368 GGGGGACAGCAGGAGGTGTGGGG - Exonic
1113584140 13:111451577-111451599 GAGCAACAGAATGAGGTGATAGG + Intergenic
1113918467 13:113889229-113889251 GAGGCACAGCAGGAGGTGAGAGG + Intergenic
1114028175 14:18548895-18548917 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1114067864 14:19080587-19080609 GAGTTAGAACATGTGGTGTTTGG - Intergenic
1114094396 14:19319439-19319461 GAGTTAGAACATGTGGTGTTTGG + Intergenic
1114363809 14:22005233-22005255 GAGTTAGAACATGCGGTGTTTGG + Intergenic
1114872334 14:26673547-26673569 GAGTGACAATATGAGGTGTTTGG + Intergenic
1115107732 14:29781047-29781069 GAGTGAGAACATGAGGTGTTTGG - Intronic
1115743998 14:36417601-36417623 GAGTGAAAACATGAGGTGTTTGG - Intergenic
1115745422 14:36431830-36431852 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1115828017 14:37299205-37299227 GAGTGAGAACATGAGGTGTTTGG - Intronic
1116246808 14:42425992-42426014 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1116509267 14:45723593-45723615 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1116609855 14:47054548-47054570 GAGTGAGAACATGAGGTGTTTGG + Intronic
1116720209 14:48486252-48486274 GAGTGACAACATGCGGTGTTTGG - Intergenic
1117105080 14:52390054-52390076 GAGTGACAACATGCGGTGTTTGG - Intergenic
1117591945 14:57279437-57279459 AAGTGACAACATGAGGTGTTTGG - Intronic
1117624946 14:57626080-57626102 GAGTGAAAACATGAGGTGTTTGG - Intronic
1117625141 14:57628530-57628552 GAGTGAAAACATGAGGTGTTTGG + Intronic
1117715845 14:58580120-58580142 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1118812283 14:69284160-69284182 GAGGAACTGCAGCAGGTGTTTGG - Intronic
1118984731 14:70744110-70744132 GAGTGAGAACATGAGGTGTTTGG - Intronic
1119896546 14:78224508-78224530 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1120130620 14:80802445-80802467 GAGTGAGAGCATGCGGTGTTTGG - Intronic
1120559107 14:85969267-85969289 GAGTTAGAACATGCGGTGTTTGG + Intergenic
1121905362 14:97736788-97736810 GAGTGACAACATGTGGTGTTTGG + Intergenic
1124187759 15:27544847-27544869 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1124392570 15:29272963-29272985 GAGGGGCAGCATCAGGTGGTTGG + Intronic
1124790832 15:32724871-32724893 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1124838676 15:33221118-33221140 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1125084572 15:35714905-35714927 GAGTGACAACATGTGGTGTTTGG + Intergenic
1125252232 15:37718042-37718064 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1125837897 15:42770010-42770032 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1126084211 15:44996081-44996103 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1126183544 15:45809500-45809522 GAGGTAATGCTTGAGCTGTTTGG + Intergenic
1126236876 15:46396003-46396025 AAGTGACAGCATGTGGTGTTTGG - Intergenic
1126326103 15:47479278-47479300 GAAGCACAGCATCAGTTGTTGGG + Intronic
1126388431 15:48118678-48118700 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1126960256 15:53985180-53985202 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1127138505 15:55949709-55949731 GAGTGAGAACATGAGGTGTTTGG - Intronic
1127568060 15:60213086-60213108 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1128720596 15:69945357-69945379 GAGTTAGAACATGCGGTGTTTGG - Intergenic
1129009241 15:72399974-72399996 GAGGTACAGCATCAGTTGTTTGG + Intronic
1129636194 15:77320892-77320914 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1130200746 15:81824449-81824471 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1130697416 15:86144570-86144592 AAGTGACAGCATGAGGTATTTGG - Intronic
1130817501 15:87453420-87453442 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1131284546 15:91046146-91046168 GAGTGACAACATGTGGTGTTTGG + Intergenic
1131409998 15:92199678-92199700 GAGGAACAGCATCAGGTGGTTGG + Intergenic
1131453758 15:92567133-92567155 GAGGGACAGCATCAGGTGGTTGG - Intergenic
1131928532 15:97413549-97413571 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1133379754 16:5320048-5320070 GAGGTAAAGCAAGTGGGGTTTGG + Intergenic
1134305937 16:13032257-13032279 GAGTGAGAACATGAGGTGTTTGG + Intronic
1134612222 16:15618531-15618553 GAGGAAATGCATGAGGTGTGGGG - Intronic
1134880124 16:17739053-17739075 GAGAGACAACATGCGGTGTTTGG - Intergenic
1135193546 16:20375618-20375640 GAGGTGCAGTAGGAGATGTTTGG - Intronic
1135269404 16:21056089-21056111 GAGGTAGTGTATGTGGTGTTGGG + Intronic
1135790137 16:25386282-25386304 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1137233437 16:46591075-46591097 GAGTGACAACATGCGGTGTTTGG - Intronic
1137308235 16:47226605-47226627 GAGTGACAACATGCGGTGTTTGG + Intronic
1137437956 16:48472749-48472771 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1138769722 16:59649034-59649056 GAGTGACAACATGAGGTGTTTGG + Intergenic
1138788166 16:59870476-59870498 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1138822341 16:60276487-60276509 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1139148312 16:64349256-64349278 GAGGTAGAGGAAGAGGTTTTAGG - Intergenic
1139222078 16:65193817-65193839 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1140054628 16:71515292-71515314 GAGGAACAGCAGGAGGTGAGGGG + Intronic
1140150031 16:72353554-72353576 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1140586565 16:76299903-76299925 GAGTGAGAACATGAGGTGTTTGG - Intronic
1140852693 16:78949556-78949578 GACATACAGCATTATGTGTTGGG - Intronic
1141357771 16:83364817-83364839 GAGGGAGAACATGTGGTGTTTGG - Intronic
1142914065 17:3119614-3119636 GAGTGACAACATGCGGTGTTTGG + Intergenic
1142934787 17:3319608-3319630 GAGTGAGAACATGAGGTGTTCGG + Intergenic
1142943250 17:3401021-3401043 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1143223371 17:5280865-5280887 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1144006468 17:11104632-11104654 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1145083931 17:19919159-19919181 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1145113850 17:20189722-20189744 GTGGTACAGCATGAGTATTTGGG + Intronic
1145164104 17:20598205-20598227 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1145845564 17:28035530-28035552 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1146096601 17:29936214-29936236 GAGTGAGAACATGAGGTGTTTGG - Intronic
1146291701 17:31612303-31612325 GAGGTAGAGAATGAGGTGGAAGG + Intergenic
1146628816 17:34455483-34455505 GAGCTACAGAGTGAGGAGTTGGG + Intergenic
1146672000 17:34745105-34745127 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1147762128 17:42805534-42805556 GAGGGACAGCATGGTGGGTTTGG + Intronic
1148450326 17:47773497-47773519 GAGGTTCAGCTTGAGGTGAGAGG - Intergenic
1148986459 17:51626786-51626808 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1148996518 17:51715124-51715146 GAGTGAGAACATGAGGTGTTTGG - Intronic
1149053330 17:52332869-52332891 GAGTGACAACATGCGGTGTTTGG + Intergenic
1149193462 17:54091503-54091525 GAGTGAAAACATGAGGTGTTTGG - Intergenic
1150090936 17:62324171-62324193 GAGGGAGAACATGGGGTGTTTGG - Intergenic
1150873610 17:68944062-68944084 GAGCGAGAACATGAGGTGTTTGG - Intronic
1151212078 17:72551967-72551989 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1151817949 17:76480748-76480770 GAGGGACTGGATGAGGAGTTAGG - Intronic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1153052300 18:910540-910562 GAGGCAGAGCCTGAGGTGGTAGG + Exonic
1153644581 18:7183926-7183948 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1153850910 18:9093387-9093409 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1153965170 18:10173798-10173820 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1154373333 18:13786286-13786308 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1154443512 18:14414070-14414092 GAGGTCCAGCCTTAGGTATTTGG - Intergenic
1155127636 18:22895155-22895177 GAGTGAGAACATGAGGTGTTTGG - Intronic
1155476346 18:26238822-26238844 GAGATAGAACATGCGGTGTTTGG + Intronic
1155549271 18:26948155-26948177 GAGTGAGAACATGAGGTGTTTGG - Intronic
1155888633 18:31239007-31239029 GAGTGACAACATGTGGTGTTTGG + Intergenic
1156025855 18:32654553-32654575 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1156256652 18:35404230-35404252 GAGTGACAACATGCGGTGTTTGG + Intergenic
1156264271 18:35471835-35471857 GAGTGACAACATGCGGTGTTTGG + Intronic
1156308660 18:35903384-35903406 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1156718688 18:40043545-40043567 GATTTACAGCAGGAGGTGATAGG + Intergenic
1156919334 18:42501425-42501447 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1157294253 18:46431126-46431148 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1157659396 18:49426304-49426326 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1158145152 18:54303994-54304016 GAGTGACAACATGTGGTGTTTGG + Intronic
1158780831 18:60648702-60648724 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1158785441 18:60706437-60706459 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1158833961 18:61310832-61310854 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1159349362 18:67251827-67251849 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1159649295 18:70958314-70958336 GAGTAAGAGCATGTGGTGTTTGG + Intergenic
1159661999 18:71108466-71108488 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1159942997 18:74422875-74422897 TAGGTCCAGCATGAGCTGTGTGG - Intergenic
1160442291 18:78902051-78902073 GAGGTGGAGCATGTGGTGTCTGG - Intergenic
1163067215 19:14806617-14806639 GAGTGAGAACATGAGGTGTTTGG + Intronic
1163076459 19:14896700-14896722 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1164402645 19:27912225-27912247 CAGGTACAGGATGAGTTGCTAGG - Intergenic
1166162370 19:40964442-40964464 GAGTGACAACATGTGGTGTTTGG + Intergenic
1166172386 19:41038910-41038932 GAGGGAGAATATGAGGTGTTTGG - Intergenic
1166425962 19:42678031-42678053 GAGTTAGAACATGTGGTGTTTGG + Intronic
1167103928 19:47419597-47419619 GAGCTACAGCACGAGGGATTGGG + Intergenic
1167169068 19:47818976-47818998 GAGCGAGAGCATGCGGTGTTTGG + Intronic
1168390771 19:56006183-56006205 GAGTGACAACATGCGGTGTTTGG - Intronic
925496316 2:4453448-4453470 GAGTAAGAACATGAGGTGTTTGG + Intergenic
925859398 2:8160226-8160248 GCGTTAGGGCATGAGGTGTTTGG - Intergenic
926505258 2:13706226-13706248 GAGGTAAAGCATGATATGTTCGG - Intergenic
926847088 2:17153587-17153609 GAGTGAGAACATGAGGTGTTTGG - Intergenic
927027470 2:19084100-19084122 GAGTGAGAACATGAGGTGTTTGG - Intergenic
927299340 2:21493153-21493175 GAGTGACAACATGCGGTGTTTGG + Intergenic
927355174 2:22164604-22164626 GAGTGAGAACATGAGGTGTTTGG + Intergenic
927516258 2:23673430-23673452 GAGAGACAGCATGTGGTGTGGGG - Intronic
928720368 2:34114086-34114108 GAGTGACAACATGTGGTGTTTGG + Intergenic
928811543 2:35233665-35233687 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
928816118 2:35296431-35296453 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
928882149 2:36108858-36108880 GAGGGAGAACATGCGGTGTTTGG - Intergenic
929068479 2:38004931-38004953 GAGTGACAACATGTGGTGTTTGG + Intronic
929546719 2:42860601-42860623 GAGGTGAAGCATGAGTGGTTGGG + Intergenic
930440405 2:51397381-51397403 GAGTGAGAGCATGGGGTGTTTGG - Intergenic
931007499 2:57868565-57868587 GAGGAACATCATGGTGTGTTGGG + Intergenic
931015778 2:57978885-57978907 GAGTTAGAACAGGAGGTGTTTGG + Intronic
931171551 2:59808726-59808748 GAGGCACAGCATGAGGGGCTGGG - Intergenic
931459757 2:62440468-62440490 GAGGGACGGCATTAGGTGATTGG + Intergenic
931556561 2:63512650-63512672 GAGTGAGAACATGAGGTGTTTGG - Intronic
931782656 2:65592076-65592098 AAGGGACAGCATGAGGTTTCGGG - Intergenic
932501415 2:72185975-72185997 GAGTGAGAACATGAGGTGTTTGG + Intronic
932745427 2:74330050-74330072 GAGGTATAGAAGGAGGTGTGTGG + Intronic
932804898 2:74774891-74774913 GAGTGAGAACATGAGGTGTTTGG + Intergenic
932985637 2:76723068-76723090 GAGTAAGAGCATGCGGTGTTTGG + Intergenic
933094900 2:78165917-78165939 GAGGGAGAACATGTGGTGTTTGG - Intergenic
933257061 2:80093237-80093259 GAGTGAGAACATGAGGTGTTTGG + Intronic
933356170 2:81211619-81211641 GAGTGAGAACATGAGGTGTTTGG - Intergenic
933451097 2:82452968-82452990 GAGTGACAGCATGTGGTGTTTGG + Intergenic
934142688 2:89063265-89063287 GAGTGAGAACATGAGGTGTTTGG + Intergenic
934226559 2:90137289-90137311 GAGTGAGAACATGAGGTGTTTGG - Intergenic
934790122 2:97052168-97052190 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
934816348 2:97330372-97330394 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
934821348 2:97378112-97378134 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
934873724 2:97893124-97893146 GAGTGAGAACATGAGGTGTTTGG + Intronic
935117741 2:100151841-100151863 GAGTGACAACATGCGGTGTTTGG + Intergenic
935397734 2:102625553-102625575 GAGTGAGAACATGAGGTGTTTGG + Intronic
935416333 2:102822968-102822990 TAGTTCCAGCATCAGGTGTTGGG + Intronic
935450778 2:103206443-103206465 GAGTGAGAACATGAGGTGTTTGG - Intergenic
935884805 2:107605026-107605048 GAGTGACAGTGTGAGGTGTTAGG - Intergenic
936696241 2:114952410-114952432 TAGATACAGTATGATGTGTTAGG + Intronic
936726841 2:115329669-115329691 GAGTGAGAACATGAGGTGTTTGG + Intronic
936736951 2:115456718-115456740 GAGTGAGAGCATGTGGTGTTTGG - Intronic
936777844 2:115995195-115995217 GAGTGAGAACATGAGGTGTTTGG + Intergenic
937143747 2:119624778-119624800 GAGGGAGAACATGCGGTGTTTGG - Intronic
937802317 2:126094959-126094981 GAGTTAGAACATGTGGTGTTTGG - Intergenic
937838020 2:126493374-126493396 GAGTGAGAACATGAGGTGTTTGG + Intergenic
937929240 2:127191941-127191963 GAGGCACAGAACGAGGTGTGGGG - Intronic
938227327 2:129627156-129627178 GAGGAACAGCAAGAGATGTGAGG + Intergenic
938281897 2:130069819-130069841 GAGTGAGAACATGAGGTGTTTGG - Intergenic
938303991 2:130237844-130237866 GAGTGAGAACATGAGGTGTTTGG - Intergenic
938332518 2:130458374-130458396 GAGTGAGAACATGAGGTGTTTGG - Intergenic
938357288 2:130662294-130662316 GAGTGAGAACATGAGGTGTTTGG + Intergenic
938423813 2:131167333-131167355 GAGTGAGAGCATGCGGTGTTTGG + Intronic
938433721 2:131269081-131269103 GAGTGAGAACATGAGGTGTTTGG + Intronic
938650990 2:133383298-133383320 GAGTGACAACATGCGGTGTTTGG + Intronic
938806707 2:134812891-134812913 GAGTGACAACATGTGGTGTTTGG - Intergenic
938976651 2:136485119-136485141 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
939793164 2:146606164-146606186 GAGTGAGAACATGAGGTGTTTGG + Intergenic
940552087 2:155172060-155172082 GAGTGAGAACATGAGGTGTTTGG + Intergenic
940732184 2:157405091-157405113 GAGTGAGAACATGAGGTGTTTGG + Intergenic
941143692 2:161816712-161816734 GAGTGACAACATGCGGTGTTTGG + Intronic
941150927 2:161915064-161915086 TAGGCACAGGATAAGGTGTTGGG - Intronic
941760258 2:169234379-169234401 GAGTGACAACATGAAGTGTTTGG + Intronic
942000475 2:171641515-171641537 GAGTGAGAACATGAGGTGTTTGG + Intergenic
943031623 2:182692427-182692449 GAGTGACAACATGGGGTGTTTGG - Intergenic
943038988 2:182781200-182781222 GAGTGACAACATGTGGTGTTTGG + Exonic
943126336 2:183797296-183797318 GAGTGAGAACATGAGGTGTTTGG - Intergenic
943145468 2:184038792-184038814 GAGAGACAGCATGATGTGTCAGG + Intergenic
943155362 2:184168414-184168436 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
943161896 2:184265082-184265104 GAGTGAGAACATGAGGTGTTTGG + Intergenic
943173351 2:184433200-184433222 GAGTGAGAGCATAAGGTGTTTGG + Intergenic
943197669 2:184775822-184775844 GGGGTACAGCACTAGATGTTTGG + Intronic
943325662 2:186494728-186494750 GAGTGAGAACATGAGGTGTTTGG - Intronic
943697834 2:190955361-190955383 GAGGGAGAACATGAAGTGTTTGG + Intronic
943974142 2:194449382-194449404 GAGTGAGAACATGAGGTGTTCGG - Intergenic
944308235 2:198202168-198202190 GAGTGAGAACATGAGGTGTTTGG - Intronic
944524791 2:200607875-200607897 GAGTAAGAGCATGTGGTGTTTGG - Intronic
945150525 2:206785553-206785575 GAGGTACAGGGTGAGGAGTGGGG + Intronic
945341374 2:208659910-208659932 GAGTGAGAACATGAGGTGTTTGG + Intronic
945351893 2:208790174-208790196 GAGTGAGAACATGAGGTGTTTGG - Intronic
945358351 2:208865466-208865488 GAGTGAGAACATGAGGTGTTTGG - Intergenic
945391207 2:209267279-209267301 GAGTGAGAACATGAGGTGTTTGG - Intergenic
945896678 2:215490690-215490712 GAGGTAGAGCATGGGATTTTGGG - Intergenic
946162499 2:217844314-217844336 GAGGTTCAGGATGATGTGTCTGG - Intronic
946500155 2:220238650-220238672 GGGCTACAACATGTGGTGTTGGG + Intergenic
946881981 2:224185533-224185555 GAGGCCCACCACGAGGTGTTTGG - Intergenic
947193791 2:227540428-227540450 GAGTTAGAACATGTGGTGTTTGG + Intronic
947223550 2:227818724-227818746 AAGGGACAGCAGGAAGTGTTTGG + Intergenic
947275390 2:228385923-228385945 GAGTGACAACATGCGGTGTTTGG + Intergenic
947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG + Intergenic
948480367 2:238246322-238246344 GAGGTACACCAGGTGGTGCTTGG - Exonic
948543989 2:238712486-238712508 GAGGTACAATGGGAGGTGTTTGG - Intergenic
948812012 2:240483918-240483940 GAGTGAGAACATGAGGTGTTTGG + Intronic
1168805022 20:667445-667467 GAGGAGCAGCACGATGTGTTGGG - Intronic
1169602520 20:7277898-7277920 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1170179348 20:13511838-13511860 GAGTGAGAACATGAGGTGTTTGG + Intronic
1172951779 20:38727076-38727098 CAGGAACAGAATGAGGAGTTGGG - Intronic
1173144950 20:40516306-40516328 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1173936242 20:46867607-46867629 GAGCGAGAACATGAGGTGTTTGG + Intergenic
1174983823 20:55427010-55427032 AAGGTAGAGCATGAGGCTTTGGG - Intergenic
1175630533 20:60531887-60531909 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1176097748 20:63352102-63352124 GAGGTGGAGCAGGAGGTGTGTGG - Intronic
1176452578 21:6877168-6877190 GAGGTCCAGCCTTAGGTATTTGG + Intergenic
1176830751 21:13742217-13742239 GAGGTCCAGCCTTAGGTATTTGG + Intergenic
1177042174 21:16127720-16127742 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1177203679 21:17986397-17986419 GAGTGAGAACATGAGGTGTTTGG + Intronic
1177329628 21:19640980-19641002 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1177470047 21:21548747-21548769 GAGTCACAGCATGAGCTTTTAGG - Intergenic
1177506877 21:22030728-22030750 GAGTGACAACATGCGGTGTTTGG - Intergenic
1177633719 21:23759041-23759063 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1177678058 21:24328183-24328205 GAGTGACAACATGCGGTGTTTGG + Intergenic
1177689723 21:24489762-24489784 GAGTGACAACATGCGGTGTTTGG - Intergenic
1177704141 21:24678275-24678297 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1177708208 21:24736890-24736912 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1178660444 21:34503320-34503342 GAGGCACAGGATGAGGTATGTGG + Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179010084 21:37549767-37549789 GAGTTAGAACATGTGGTGTTTGG + Intergenic
1179279194 21:39919540-39919562 GATCTACAGCATTAGGCGTTAGG + Intronic
1179319804 21:40279870-40279892 GAGTGAGAACATGAGGTGTTTGG - Intronic
1179602187 21:42486761-42486783 GGGGTACAGAGTGAGGTGTATGG + Intronic
1180394204 22:12314493-12314515 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1180399362 22:12394743-12394765 GAGTGACAGCATGCAGTGTTTGG - Intergenic
1180405542 22:12550256-12550278 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1180452297 22:15475948-15475970 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1180486338 22:15803156-15803178 GAGTTAGAACATGTGGTGTTTGG - Intergenic
1182179679 22:28334084-28334106 GAGTGACAACATAAGGTGTTTGG + Intronic
1182563647 22:31181762-31181784 GAGTGAGAACATGAGGTGTTTGG - Intronic
1182953413 22:34398462-34398484 GAGTGACAACATGTGGTGTTTGG - Intergenic
1183000891 22:34857679-34857701 GAGTGACAACATGTGGTGTTTGG + Intergenic
1183640903 22:39091831-39091853 GAGGGACAGCATGAGGGGCAGGG + Intergenic
1183747176 22:39698613-39698635 GAGGTAAAGGAGGAGGTGATGGG - Intergenic
1183753208 22:39734133-39734155 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1184160479 22:42694465-42694487 GATGTTCAGCATGAGGTCTGGGG + Intronic
949223968 3:1671118-1671140 GAGTGAGAACATGAGGTGTTTGG + Intergenic
949225398 3:1687539-1687561 GAGTGAGAACATGAGGTGTTTGG - Intergenic
949434793 3:4017287-4017309 GAGGGAGAACATGTGGTGTTTGG + Intronic
949612777 3:5719929-5719951 GAGTAAGAGCATGAGGTGTTTGG - Intergenic
949659912 3:6267141-6267163 GAGTGAGAACATGAGGTGTTTGG + Intergenic
950168413 3:10818700-10818722 GAGGGACAGAATGAGGGATTTGG + Intronic
950550467 3:13663052-13663074 GAGTTAGAACATGCGGTGTTTGG + Intergenic
950701521 3:14753246-14753268 GAGTGACAACATGTGGTGTTTGG - Intronic
951300388 3:20989237-20989259 GAGTGAGAACATGAGGTGTTTGG + Intergenic
951393783 3:22139523-22139545 GAGTGAGAACATGAGGTGTTTGG - Intronic
951418107 3:22449637-22449659 GAGTGACAACATGCGGTGTTTGG - Intergenic
951503434 3:23415977-23415999 GAGTGACAACATGTGGTGTTTGG + Intronic
952517107 3:34116312-34116334 GAGTGAGAACATGAGGTGTTTGG + Intergenic
953018680 3:39100370-39100392 GTGGTAGAGCATCAGGTGGTGGG + Exonic
953194976 3:40723817-40723839 GAGGAACACCACGGGGTGTTTGG - Intergenic
953300077 3:41765316-41765338 GAGTGAGAGCATGCGGTGTTTGG - Intronic
953582632 3:44171180-44171202 GAGGTAGAGCAGCAGGTGGTAGG - Intergenic
953652156 3:44816473-44816495 GAGTGAGAACATGAGGTGTTTGG + Intronic
954378162 3:50205621-50205643 GAGGTACAGCAGGAGGTCGGCGG + Intronic
955196998 3:56813822-56813844 GAGGAAAAGGATGTGGTGTTTGG - Intronic
955423015 3:58758770-58758792 GAGGGAGAACATGCGGTGTTTGG + Intronic
955440664 3:58951665-58951687 GAGTGAGAACATGAGGTGTTTGG - Intronic
956215914 3:66848691-66848713 GAGTGAGAACATGAGGTGTTTGG - Intergenic
956266221 3:67398929-67398951 GAGTGACAACATGTGGTGTTTGG - Intronic
956354083 3:68371459-68371481 GAGCAAGAACATGAGGTGTTTGG + Intronic
956395005 3:68816073-68816095 GAGTTAGAACATGCGGTGTTTGG - Intronic
956455825 3:69419817-69419839 GAGATACAGGAAGAGATGTTTGG + Intronic
956817033 3:72917011-72917033 GAGGTAAAGGATGAGGTGGGCGG + Intronic
957218486 3:77351855-77351877 GAGTGAGAACATGAGGTGTTTGG - Intronic
957383993 3:79471843-79471865 GAGGGAGAACATGCGGTGTTTGG - Intronic
957420719 3:79966061-79966083 GAGGGAGAACATGCGGTGTTTGG - Intergenic
957578554 3:82040528-82040550 GAGTGAGAACATGAGGTGTTTGG - Intergenic
957648598 3:82969383-82969405 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
957891551 3:86365366-86365388 GAGAGACAGCATGAGGTGGTGGG - Intergenic
957906415 3:86561852-86561874 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
958140041 3:89550749-89550771 GAGTGAGAACATGAGGTGTTTGG + Intergenic
958517548 3:95137719-95137741 GAGTGAGAACATGAGGTGTTTGG - Intergenic
958518953 3:95158957-95158979 GAAGGAGAACATGAGGTGTTTGG + Intergenic
958561660 3:95755993-95756015 GAGGGAGAACATGTGGTGTTTGG + Intergenic
958567639 3:95835325-95835347 GAGTGACAACATGTGGTGTTTGG - Intergenic
958680783 3:97329049-97329071 GAGTGACAACATGCGGTGTTTGG + Intronic
958697153 3:97542327-97542349 GAGCGAGAGCATGCGGTGTTTGG + Intronic
958752617 3:98210586-98210608 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
959020227 3:101180910-101180932 TGGGTACAGCTTGAGGGGTTTGG - Intergenic
959666064 3:108922888-108922910 GAGTGAGAACATGAGGTGTTTGG + Intronic
959676099 3:109037675-109037697 GAGTGAGAACATGAGGTGTTTGG + Intronic
959884744 3:111487019-111487041 GAGTGAGAGCATGTGGTGTTTGG - Intronic
960273918 3:115705114-115705136 GTGGTTCGGCATGATGTGTTTGG - Intronic
960912936 3:122667397-122667419 GAGTGACAACATGCGGTGTTTGG + Intergenic
961913774 3:130348356-130348378 GAGTGACAACATGCGGTGTTTGG + Intronic
961953728 3:130778081-130778103 GGTGTACAGCATGATGTGTGAGG - Intergenic
962082521 3:132155745-132155767 GAAGTACAGCATGACATGATTGG + Intronic
962190592 3:133306599-133306621 GAGTGAGAGCATGCGGTGTTTGG + Intronic
962430850 3:135318042-135318064 GAGTGAGAACATGAGGTGTTTGG + Intergenic
962691445 3:137902788-137902810 GAGGGAGAACATGTGGTGTTTGG - Intergenic
962701596 3:138005471-138005493 GAGTGAGAACATGAGGTGTTTGG + Intronic
963307383 3:143668239-143668261 GAGTGAGAGCATGCGGTGTTTGG - Intronic
963987558 3:151614579-151614601 GAGTGACAGCATGCGGTGTTTGG - Intergenic
964262342 3:154853411-154853433 GAGTAAGAACATGAGGTGTTTGG + Intergenic
964460037 3:156914396-156914418 GAGTGAGAACATGAGGTGTTTGG + Intronic
964557094 3:157951800-157951822 GAGTGAGAACATGAGGTGTTTGG - Intergenic
964581643 3:158246155-158246177 GAGTGAGAGCATGCGGTGTTTGG - Intronic
964587596 3:158324465-158324487 GAGTGAGAACATGAGGTGTTTGG + Intronic
964689581 3:159435396-159435418 TAGGTGCAGGATGAAGTGTTTGG - Intronic
964695737 3:159505704-159505726 GAGTGAGAACATGAGGTGTTTGG + Intronic
964838943 3:160972432-160972454 GAGTGAGAACATGAGGTGTTTGG + Intronic
965181457 3:165408757-165408779 GAGTGACAACATGCGGTGTTTGG - Intergenic
965288406 3:166845661-166845683 GAGTGACAGCATGAGGTGTTTGG + Intergenic
965365895 3:167799275-167799297 GAGTGACAACATGCGGTGTTTGG + Intronic
965800716 3:172491054-172491076 GAGTGACAACATGCGGTGTTTGG + Intergenic
965889775 3:173498287-173498309 GAGTGACAACATGCGGTGTTGGG + Intronic
966101750 3:176277648-176277670 GAGTCAGAACATGAGGTGTTTGG + Intergenic
966131023 3:176639878-176639900 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
966237757 3:177721020-177721042 GAGTGAGAACATGAGGTGTTTGG + Intergenic
967507541 3:190270265-190270287 GAGGGAGAACATGCGGTGTTTGG - Intergenic
967639164 3:191840398-191840420 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
967706759 3:192660268-192660290 GAGTGAGAACATGAGGTGTTTGG - Intronic
968272572 3:197415805-197415827 GAGTGAGAACATGAGGTGTTTGG - Intergenic
969848019 4:9934890-9934912 GAGTGAGAGCATGCGGTGTTTGG + Intronic
969899019 4:10331284-10331306 GAGTGAGAACATGAGGTGTTTGG + Intergenic
970079473 4:12264240-12264262 GAGTGAGAACATGAGGTGTTTGG + Intergenic
970141255 4:12984441-12984463 GAGTGAGAACATGAGGTGTTTGG + Intergenic
970144622 4:13022200-13022222 GAGTGAGAACATGAGGTGTTTGG - Intergenic
970225989 4:13857219-13857241 GAGTGACAACATGCGGTGTTCGG + Intergenic
970304214 4:14714954-14714976 GAGTGAGAACATGAGGTGTTTGG - Intergenic
970679039 4:18486113-18486135 GAGTGAGAACATGAGGTGTTTGG - Intergenic
970893253 4:21071875-21071897 GAGTGACAACATGTGGTGTTTGG + Intronic
971160591 4:24129906-24129928 GAGTGAGAACATGAGGTGTTTGG - Intergenic
971726414 4:30318465-30318487 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
971829766 4:31675718-31675740 GAATTACAGCAGGAGGTTTTTGG - Intergenic
971839689 4:31835198-31835220 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
972104897 4:35471519-35471541 GAGGGACAACATGTGGTATTTGG - Intergenic
972914320 4:43857046-43857068 GAGTTAGAACATGTGGTGTTTGG + Intergenic
973013370 4:45105482-45105504 GAGTCAGAGCATGCGGTGTTTGG + Intergenic
973669472 4:53201257-53201279 GAGTGAGAACATGAGGTGTTTGG + Intronic
973733129 4:53842912-53842934 GAGGGGCAGCATCAGGTGGTTGG + Intronic
973870829 4:55164508-55164530 GAGTGACAACATGCGGTGTTTGG + Intergenic
974230580 4:59108835-59108857 GAGTGAGAACATGAGGTGTTTGG + Intergenic
974266509 4:59592766-59592788 GAGTGAGAACATGAGGTGTTTGG - Intergenic
974283979 4:59839569-59839591 GAGTGAGAACATGAGGTGTTTGG + Intergenic
974331157 4:60480777-60480799 GAGTGAAAGCATGTGGTGTTTGG + Intergenic
974522019 4:62994298-62994320 GAGGGAGAACATGTGGTGTTTGG + Intergenic
974536222 4:63179067-63179089 GAGTGAGAACATGAGGTGTTTGG + Intergenic
974658234 4:64853049-64853071 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
974696921 4:65388050-65388072 GAGTGAGAGCATGAGGTGTTTGG + Intronic
974740655 4:66002418-66002440 GAGTGAGAACATGAGGTGTTTGG - Intergenic
974829838 4:67176410-67176432 GAGTGACAACATGTGGTGTTTGG - Intergenic
975023023 4:69514321-69514343 GAGTGAGAGCATGCGGTGTTTGG + Intronic
975050047 4:69851882-69851904 GAGTGAGAACATGAGGTGTTTGG - Intronic
975075792 4:70207448-70207470 GAGGGAGAACATGTGGTGTTTGG + Intergenic
975241215 4:72061691-72061713 GAGTGAGAACATGAGGTGTTTGG - Intronic
975389160 4:73796551-73796573 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
975514220 4:75227245-75227267 GAGTGAGAACATGAGGTGTTTGG - Intergenic
975807498 4:78127985-78128007 GAGTGAGAACATGAGGTGTTTGG + Intronic
975886873 4:78976666-78976688 GAGTGAGAACATGAGGTGTTTGG + Intergenic
975929808 4:79506190-79506212 GAGTGAGAACATGAGGTGTTTGG + Intergenic
976003392 4:80399599-80399621 GAGTGAGAACATGAGGTGTTTGG - Intronic
976379830 4:84386749-84386771 GAGGTGCAGCATGAAGAGCTGGG - Intergenic
976466998 4:85381632-85381654 GAGGGAGAACATGTGGTGTTTGG - Intergenic
976490195 4:85661750-85661772 GAGTGAGAGCATGCGGTGTTTGG + Intronic
976725645 4:88213260-88213282 GAAGTACAGTATGAGTTGTCAGG - Intronic
976741351 4:88360651-88360673 GAGTGAGAACATGAGGTGTTTGG - Intergenic
976938368 4:90667575-90667597 GAGTGAGAGCATGAAGTGTTTGG + Intronic
976969199 4:91083319-91083341 GAGTGAGAACATGAGGTGTTTGG - Intronic
977116840 4:93039226-93039248 GAGTGACAACATGCGGTGTTTGG - Intronic
977461013 4:97325242-97325264 GAGTGACAACATGTGGTGTTTGG + Intronic
977515670 4:98018250-98018272 GAGGGAGAACATGCGGTGTTTGG + Intronic
977711744 4:100134371-100134393 GAGTGAGAACATGAGGTGTTTGG + Intergenic
977721131 4:100241567-100241589 GAGGGGCAGCATCAGGTGGTCGG + Intergenic
977790331 4:101092670-101092692 GAGTGAGAACATGAGGTGTTTGG + Intronic
977795853 4:101163671-101163693 GAAGCACAGCAGTAGGTGTTAGG + Intronic
977995508 4:103494600-103494622 GTGGTACAACCAGAGGTGTTAGG + Intergenic
978015948 4:103746788-103746810 GAGTGAGAACATGAGGTGTTTGG - Intergenic
978051400 4:104204765-104204787 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
978121126 4:105080315-105080337 GAGTGAGAACATGAGGTGTTTGG + Intergenic
978522894 4:109635035-109635057 GAGTTAGAACATGTGGTGTTTGG + Intronic
978666767 4:111193724-111193746 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
978695394 4:111570995-111571017 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
979190286 4:117848730-117848752 GAACTACAACATGTGGTGTTTGG - Intergenic
979650484 4:123124396-123124418 GAGTTAGAACATGAGGTGTTTGG - Intronic
980117467 4:128692947-128692969 GAGGGACAGCATCAGGTGGTTGG - Intergenic
980215129 4:129842794-129842816 GAGTGAGAGCATGAGGCGTTTGG + Intergenic
980395358 4:132207081-132207103 GAGTGAGAACATGAGGTGTTTGG + Intergenic
980542575 4:134213677-134213699 GAGTGACAACATGTGGTGTTTGG - Intergenic
980549922 4:134321437-134321459 GAGTGACAACATGCGGTGTTTGG - Intergenic
980857733 4:138460100-138460122 GAGTGAGAACATGAGGTGTTTGG + Intergenic
980987213 4:139707284-139707306 GAGTGAGAACATGAGGTGTTTGG + Intronic
981053907 4:140340208-140340230 GAGTGACAACATGAGGTGTTTGG - Intronic
981201633 4:141986879-141986901 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
981260900 4:142717648-142717670 GAGTGACAACATGTGGTGTTTGG - Intronic
981262523 4:142738367-142738389 GAGTGACAACATGCGGTGTTTGG - Intronic
981294389 4:143114627-143114649 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
982310329 4:153978311-153978333 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
982620909 4:157703778-157703800 GAGTTAGAACATGTGGTGTTTGG - Intergenic
982690704 4:158544680-158544702 GAGTGAGAACATGAGGTGTTTGG + Intronic
982852434 4:160336717-160336739 GAGTGAGAACATGAGGTGTTTGG + Intergenic
982884370 4:160759855-160759877 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
983251681 4:165353172-165353194 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
983706319 4:170664581-170664603 GAGGGAGAACATGCGGTGTTGGG + Intergenic
983879595 4:172918147-172918169 GAGTGAGAGCATGCGGTGTTTGG - Intronic
983953351 4:173668553-173668575 GAGTTAGAACATGCGGTGTTTGG + Intergenic
983963358 4:173780865-173780887 GAGTGAGAACATGAGGTGTTTGG - Intergenic
983971870 4:173885323-173885345 GAGTTAGAACATGTGGTGTTTGG + Intergenic
984163257 4:176279638-176279660 GAGTGAGAACATGAGGTGTTTGG + Intergenic
984270031 4:177538341-177538363 GAGTGAGAACATGAGGTGTTTGG - Intergenic
984477140 4:180249940-180249962 GAGTGAGAACATGAGGTGTTTGG - Intergenic
985366855 4:189240223-189240245 GAGTGAGAACATGAGGTGTTTGG + Intergenic
985981891 5:3476874-3476896 GAGTGAGAACATGAGGTGTTTGG + Intergenic
986344045 5:6817884-6817906 GAGAGAGAGCATGCGGTGTTTGG + Intergenic
986535507 5:8782796-8782818 GAGTGAGAACATGAGGTGTTTGG + Intergenic
987180424 5:15362007-15362029 GAGTGAGAACATGAGGTGTTTGG - Intergenic
987305423 5:16632882-16632904 GAGTGACAACATGTGGTGTTTGG + Intergenic
987462507 5:18229627-18229649 GAGTGAGAGCATGAGGTGTTTGG - Intergenic
987792490 5:22586246-22586268 GAGTGAGAGCATGCGGTGTTTGG - Intronic
988381386 5:30500861-30500883 TGGGTACAGGATGAGGTATTAGG + Intergenic
988627482 5:32893086-32893108 GAGTGACAACATGTGGTGTTTGG + Intergenic
989448987 5:41564763-41564785 GAGTGAGAACATGAGGTGTTTGG + Intergenic
989680210 5:44019631-44019653 GAGTGACAACATGCGGTGTTTGG - Intergenic
989825860 5:45853766-45853788 GAGTGACAACATGTGGTGTTTGG - Intergenic
989827410 5:45874532-45874554 GAGTGAGAACATGAGGTGTTTGG + Intergenic
989834756 5:45973156-45973178 GAGTGAGAACATGAGGTGTTTGG + Intergenic
989835205 5:45979950-45979972 GAGTAACAACATGTGGTGTTTGG + Intergenic
990183196 5:53185258-53185280 GAGTGACAACATGTGGTGTTTGG + Intergenic
990257147 5:53982418-53982440 GAGTGAGAACATGAGGTGTTTGG + Intronic
990653484 5:57928729-57928751 GAGTGAGAACATGAGGTGTTTGG - Intergenic
990859850 5:60314719-60314741 GAGTGACAACATGCGGTGTTTGG + Intronic
991104741 5:62831630-62831652 GAGAGAGAGCATGAGGTGTGGGG - Intergenic
991171124 5:63626828-63626850 GAGTGACAACATGCGGTGTTTGG + Intergenic
991180839 5:63748839-63748861 GAGTGAGAACATGAGGTGTTTGG - Intergenic
991215357 5:64153478-64153500 ATGGTACATCATGGGGTGTTTGG - Intergenic
991931716 5:71759430-71759452 GAGTGAGAACATGAGGTGTTTGG + Intergenic
992603198 5:78426027-78426049 GAGTGAGAACATGAGGTGTTTGG + Intronic
992740026 5:79764234-79764256 GAGTGAGAACATGAGGTGTTTGG + Intronic
993083884 5:83339382-83339404 GAGTGACAACATGTGGTGTTTGG - Intronic
993127248 5:83850688-83850710 GAGTGAGAACATGAGGTGTTTGG - Intergenic
993131335 5:83902294-83902316 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
993202629 5:84836322-84836344 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
993313941 5:86375447-86375469 GAGTGAGAACATGAGGTGTTTGG - Intergenic
993368232 5:87059040-87059062 GAGTGAGAACATGAGGTGTTTGG - Intergenic
993795262 5:92258785-92258807 GAGTGAAAGCATGTGGTGTTTGG + Intergenic
994288379 5:97997202-97997224 GAGTGAGAACATGAGGTGTTTGG - Intergenic
995198331 5:109398540-109398562 GAGTGACAACATGTGGTGTTTGG - Intronic
995316755 5:110783126-110783148 GAGCTAGAACATGTGGTGTTTGG + Intergenic
995383758 5:111565821-111565843 GAGTGAGAACATGAGGTGTTTGG + Intergenic
995513195 5:112928382-112928404 GAGGTACAGCATAATTTGTCAGG + Intergenic
995893669 5:116985829-116985851 GAGGGAGAACATGTGGTGTTTGG + Intergenic
995941594 5:117592400-117592422 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
996286980 5:121805532-121805554 GAGTTAGAACATGCGGTGTTTGG - Intergenic
998440012 5:142151256-142151278 GAGGTATAGCATGACATGGTTGG + Intronic
998454891 5:142264174-142264196 GAGTGAGAACATGAGGTGTTTGG + Intergenic
999078653 5:148822532-148822554 GAGTGAGAACATGAGGTGTTTGG + Intergenic
999084747 5:148877569-148877591 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
999217453 5:149947120-149947142 GAGGCATAGGGTGAGGTGTTAGG - Intergenic
999484600 5:151983206-151983228 GAGTGACAACATGCGGTGTTTGG + Intergenic
999581207 5:153040398-153040420 GAGTGAGAACATGAGGTGTTTGG - Intergenic
999938215 5:156511775-156511797 TAGGTACAGCAAGAGGTCTGAGG - Intronic
1000421185 5:161039810-161039832 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1000472575 5:161663845-161663867 GAGGTACAGCATGAGGTGTTAGG + Intronic
1000541227 5:162542525-162542547 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1000665105 5:163985103-163985125 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1000797827 5:165687663-165687685 AAGTGAGAGCATGAGGTGTTTGG + Intergenic
1000819371 5:165964663-165964685 GAGTGACAACATGTGGTGTTTGG + Intergenic
1000859880 5:166444768-166444790 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1001832059 5:174797266-174797288 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1001891841 5:175345879-175345901 GAGTTAGAACATGAGTTGTTTGG - Intergenic
1002841512 6:910787-910809 GAGGGACAGCATGGGATGTGAGG - Intergenic
1003597726 6:7489055-7489077 AAGGTACAGCATGGTGGGTTTGG - Intergenic
1003696558 6:8411654-8411676 GGGGTCCAGCATGAGGAATTCGG - Intergenic
1004280117 6:14273393-14273415 GAGGCACAGCACGAGGTATTTGG - Intergenic
1004465024 6:15877066-15877088 GAGTGAGATCATGAGGTGTTTGG - Intergenic
1004593793 6:17079661-17079683 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1004969084 6:20888603-20888625 GAGTGAGAACATGAGGTGTTTGG + Intronic
1005772816 6:29092913-29092935 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1006115362 6:31773325-31773347 GAGGTGCAGCATGTGGTGAGGGG + Exonic
1006234595 6:32617580-32617602 GAGTGACAACATGCGGTGTTTGG + Intergenic
1006949500 6:37809761-37809783 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1007169191 6:39850403-39850425 GAGTTAGAGAACGAGGTGTTTGG - Intronic
1008054157 6:46929250-46929272 GAGTGAGAACATGAGGTGTTTGG - Intronic
1008233039 6:49008778-49008800 GAGGGAGAACATGAGTTGTTTGG + Intergenic
1008732511 6:54499898-54499920 GAGTGACAACATGCGGTGTTTGG + Intergenic
1008829571 6:55741432-55741454 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1008835096 6:55817508-55817530 GAGTGAGAACATGAGGTGTTTGG - Intronic
1008979446 6:57466054-57466076 GAGTGAGAACATGAGGTGTTTGG + Intronic
1009167584 6:60359044-60359066 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1009247709 6:61260149-61260171 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1009511042 6:64549969-64549991 GAGGGAGAACATGCGGTGTTTGG + Intronic
1009690015 6:67018362-67018384 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1009708770 6:67290440-67290462 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1009762275 6:68023065-68023087 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1010092736 6:72004102-72004124 GAGTGAGAACATGAGGTGTTTGG + Intronic
1010093529 6:72012238-72012260 GAGTGACAACATGCGGTGTTTGG - Intronic
1010247721 6:73677532-73677554 TAATTAAAGCATGAGGTGTTTGG + Intergenic
1010309921 6:74373278-74373300 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1010316761 6:74460258-74460280 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1010361447 6:74999755-74999777 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1010473218 6:76254743-76254765 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1010565626 6:77408960-77408982 GAGTGACAACATGTGGTGTTTGG - Intergenic
1010643580 6:78360116-78360138 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1010899864 6:81413480-81413502 AAGGAACAGCATGAGCTCTTGGG + Intergenic
1011282951 6:85695030-85695052 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1011349841 6:86410334-86410356 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1011405829 6:87014712-87014734 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1011910124 6:92425545-92425567 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1011932280 6:92729156-92729178 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1011974992 6:93284754-93284776 GAGTGAGAACATGAGGTGTTTGG - Intronic
1012434307 6:99198640-99198662 GAGTTAGAACATGAGGTGTTTGG + Intergenic
1012613459 6:101246210-101246232 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1012787334 6:103647615-103647637 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1013019908 6:106203985-106204007 GAGTGAGAACATGAGGTGTTTGG - Intronic
1013549299 6:111191252-111191274 GAGTGAGAGCATGTGGTGTTTGG + Intronic
1013880376 6:114892042-114892064 GAGCGAGAGCATGCGGTGTTTGG + Intergenic
1014041971 6:116838659-116838681 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1014061939 6:117081938-117081960 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1014165488 6:118219926-118219948 GAGTGAGAACATGAGGTGTTTGG - Intronic
1014180657 6:118380926-118380948 GAGTGACAACATGCGGTGTTTGG - Intergenic
1014274955 6:119377310-119377332 GAGTGACAACATGCGGTGTTTGG - Intergenic
1014449499 6:121566271-121566293 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1014480873 6:121935126-121935148 GAGGGAGAGCATGCGGTGTTAGG + Intergenic
1014957233 6:127635811-127635833 GAGTAAGAACATGAGGTGTTTGG + Intergenic
1015358703 6:132310754-132310776 GAGTGACAGTATGTGGTGTTTGG - Intronic
1015367108 6:132408466-132408488 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1015515655 6:134080354-134080376 GAGGGGCAGCATCAGGTGGTTGG - Intergenic
1015563890 6:134545714-134545736 GAGTGACAACATGTGGTGTTTGG + Intergenic
1015702680 6:136053291-136053313 GAGTTAGAACATGCGGTGTTTGG + Intronic
1015892663 6:137984024-137984046 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1016073573 6:139770304-139770326 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1016148019 6:140700768-140700790 GAGTGACAACATGTGGTGTTTGG + Intergenic
1016201994 6:141421478-141421500 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1016275451 6:142346783-142346805 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1016730768 6:147425143-147425165 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1017354214 6:153483065-153483087 GAGGGGCAGCATCAGGTGGTTGG - Intergenic
1017792739 6:157815796-157815818 GAGTGAGAACATGAGGTGTTTGG - Intronic
1018094257 6:160371415-160371437 GAGTGAGAACATGAGGTGTTTGG + Intronic
1018104110 6:160466785-160466807 GAGTGACAACATGCGGTGTTTGG + Intergenic
1018749850 6:166794763-166794785 GAGTGACAACATGTGGTGTTTGG - Intronic
1019255743 7:49594-49616 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1020870690 7:13625163-13625185 GAGTGACAACATGTGGTGTTTGG + Intergenic
1021201221 7:17730207-17730229 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1021303827 7:19006634-19006656 GAGTGACAACATGCGGTGTTTGG - Intergenic
1021305698 7:19029248-19029270 GAGTGACAACATGTGGTGTTTGG - Intronic
1021658970 7:22899230-22899252 GAGGGACAGCATGGGGAGTCTGG - Intergenic
1022416436 7:30181640-30181662 GAGGCCTAGCAGGAGGTGTTTGG - Intergenic
1023363019 7:39434866-39434888 GAGTGAGAACATGAGGTGTTTGG + Intronic
1023381552 7:39613220-39613242 GTGGTACAGCAGGAGGTGAGCGG - Intergenic
1024434301 7:49331677-49331699 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1024929389 7:54654040-54654062 GAGGGACACCATGAGGTGGTTGG - Intergenic
1025545027 7:62154640-62154662 GAGTGACAACATGCGGTGTTTGG - Intergenic
1025869753 7:65420643-65420665 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1027570422 7:79859359-79859381 GAGCAAGAGCATGTGGTGTTTGG - Intergenic
1027728865 7:81843740-81843762 GAGTGACAACATGAAGTGTTTGG + Intergenic
1027762359 7:82296017-82296039 GAGTGAGAACATGAGGTGTTTGG - Intronic
1027887749 7:83931129-83931151 GAGATACAGCATGTGATGTTGGG + Intergenic
1028146113 7:87321957-87321979 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1028159640 7:87471123-87471145 GAGTGAGAACATGAGGTGTTTGG - Intronic
1028407009 7:90486158-90486180 GATGTACAGCAAGAAGTGATTGG + Intronic
1028953405 7:96662427-96662449 GAGTGAGAGCATGCGGTGTTTGG - Intronic
1029241195 7:99164396-99164418 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1029319644 7:99747275-99747297 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1029637955 7:101797894-101797916 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1029849682 7:103448596-103448618 GAGTGAGAACATGAGGTGTTGGG + Intergenic
1029941570 7:104485857-104485879 GAGTGAGAACATGAGGTGTTTGG + Intronic
1029950881 7:104584216-104584238 GAGTTAGAACATGCGGTGTTTGG - Intronic
1029964160 7:104721296-104721318 GAGGGAGAGCATGCGGTGTTTGG - Intronic
1030121991 7:106119105-106119127 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1030268611 7:107646562-107646584 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1030395223 7:108977988-108978010 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1030400520 7:109043379-109043401 GAGTGAGAACATGAGGTGTTCGG - Intergenic
1030745927 7:113166262-113166284 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1030781287 7:113603481-113603503 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1030913327 7:115280109-115280131 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1030973472 7:116090875-116090897 GAGTGACAACATGTGGTGTTTGG - Intronic
1031139285 7:117923998-117924020 GAGTTAGAACATGCGGTGTTTGG - Intergenic
1031170292 7:118285038-118285060 GAGTGAGAGCATGAGGTGTTTGG - Intergenic
1031244997 7:119300270-119300292 GAGTGAAAACATGAGGTGTTTGG + Intergenic
1031357375 7:120803354-120803376 GAGGAACAGCTGGAGGTATTTGG - Intronic
1031394297 7:121253220-121253242 GAGTGAGAACATGAGGTGTTTGG - Intronic
1031644763 7:124210748-124210770 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1031935850 7:127735063-127735085 CAGGTAGAGCGTGAGGTGCTGGG + Intronic
1032603167 7:133321502-133321524 GAGTGAGAACATGAGGTGTTTGG + Intronic
1032677347 7:134143546-134143568 GATGTACAGCATGATGTTATGGG + Intronic
1032882938 7:136109137-136109159 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1033571745 7:142636386-142636408 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1034025523 7:147699358-147699380 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1034114668 7:148573670-148573692 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1034570338 7:151950696-151950718 GCGGAACAGCATGATGTGTGTGG - Intergenic
1035269075 7:157709418-157709440 GTGGGACAGAATGAGGTGCTGGG + Intronic
1035711794 8:1722841-1722863 GAGTAAGAACATGAGGTGTTTGG - Intergenic
1035888080 8:3314028-3314050 GAGTGAGAACATGAGGTGTTTGG - Intronic
1035895156 8:3392014-3392036 GAGTGAGAACATGAGGTGTTTGG - Intronic
1036445144 8:8815099-8815121 GAGTGACAACATGCGGTGTTTGG + Intronic
1036610212 8:10343329-10343351 GACGTACAGCATGGATTGTTGGG - Intronic
1037028723 8:14073950-14073972 GAGTGACAACATGCGGTGTTTGG + Intergenic
1037231113 8:16660079-16660101 GAGTGACAACATGCGGTGTTTGG - Intergenic
1037821764 8:22138565-22138587 GAGGCACAGCATGAGGGTGTGGG + Intronic
1037998966 8:23374182-23374204 GAGTGACAACATGTGGTGTTTGG + Intronic
1039193072 8:34999060-34999082 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1039245112 8:35600035-35600057 GAGTGAGAACATGAGGTGTTTGG + Intronic
1039305786 8:36260978-36261000 GAGTGACAACATGCGGTGTTAGG - Intergenic
1039331891 8:36546804-36546826 GAGGGACAGCATCAGGTGGTTGG + Intergenic
1039425907 8:37485848-37485870 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1039685397 8:39796274-39796296 GAGGGAGAACATGTGGTGTTTGG + Intronic
1040368035 8:46740123-46740145 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1040611992 8:48994128-48994150 GAGTGACAACATGTGGTGTTTGG + Intergenic
1040712352 8:50204802-50204824 GAGTGACAACATGCGGTGTTTGG + Intronic
1041130912 8:54698796-54698818 GAGTGAAAACATGAGGTGTTTGG - Intergenic
1041213632 8:55578324-55578346 GAGACAGAGCATGAAGTGTTTGG - Intergenic
1041384938 8:57291158-57291180 GAGTGACAACATGCGGTGTTTGG + Intergenic
1041400593 8:57440042-57440064 GAGGAACAGCAGGAAGTGGTTGG + Intergenic
1041424880 8:57709283-57709305 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1042036024 8:64534698-64534720 GAGTAAGAACATGAGGTGTTTGG - Intergenic
1042036147 8:64536221-64536243 GAGTAAGAACATGAGGTGTTTGG + Intergenic
1042630841 8:70814201-70814223 GAGTGACAACATGCGGTGTTTGG - Intergenic
1042754080 8:72190383-72190405 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1042872763 8:73413075-73413097 GAAGTGCAGCAGGAGGTGTGTGG + Intergenic
1042940166 8:74099386-74099408 GAGGGGCAGCATAAGGTGGTTGG - Intergenic
1043314605 8:78904829-78904851 GAGGTGGAGGATGAGGTGTCGGG - Intergenic
1043335201 8:79167447-79167469 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1043412193 8:80009184-80009206 GAGTAAGAACATGAGGTGTTTGG - Intronic
1043753313 8:83969064-83969086 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1043849857 8:85204450-85204472 GAGTGAGAACATGAGGTGTTTGG - Intronic
1043884282 8:85580624-85580646 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1043889363 8:85639577-85639599 GAGGGAGAACATGGGGTGTTTGG - Intergenic
1044283299 8:90381327-90381349 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1044594639 8:93946820-93946842 GAGTGACAGCATGCGGTGTTTGG + Intergenic
1044759268 8:95500270-95500292 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1045378781 8:101602059-101602081 GAGTGAGAACATGAGGTGTTTGG + Intronic
1045394046 8:101742906-101742928 GAGTTAGAACATGTGGTGTTTGG + Intronic
1045483836 8:102614552-102614574 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1046005888 8:108483102-108483124 AAGATACAGCAAGAGATGTTAGG - Intronic
1046120324 8:109838261-109838283 GAGGGAGAACATGTGGTGTTTGG - Intergenic
1046311443 8:112442263-112442285 GGGGTATAGTAGGAGGTGTTTGG - Intronic
1046446282 8:114324853-114324875 GAGTGACAACATGCGGTGTTTGG - Intergenic
1046858590 8:119065200-119065222 GCTGTACAGCAGGAGGTGTGCGG + Intronic
1047150957 8:122262183-122262205 GAGTGAAAACATGAGGTGTTTGG + Intergenic
1047712132 8:127562925-127562947 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1047731626 8:127733640-127733662 GAGGCACAGCAGAAGGTGATGGG - Intergenic
1047957978 8:129989877-129989899 GAGTGAGAACATGAGGTGTTTGG + Intronic
1048055662 8:130860873-130860895 GAGTGACAACATGCGGTGTTTGG + Intronic
1048144841 8:131831354-131831376 GAGTGACAACATGCGGTGTTTGG - Intergenic
1048424233 8:134307748-134307770 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1048716603 8:137277894-137277916 GAGCAACAGCAAGAGGTGCTAGG + Intergenic
1048743769 8:137590913-137590935 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1048751615 8:137683394-137683416 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1048763103 8:137818463-137818485 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1049131965 8:140853423-140853445 GAGGGAGAACATGTGGTGTTTGG + Intronic
1050221147 9:3391647-3391669 GAGGTCAAGAATGAAGTGTTGGG + Intronic
1050400971 9:5254444-5254466 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1050432915 9:5580143-5580165 AAGGTATAGCAGAAGGTGTTAGG + Intergenic
1050517028 9:6455371-6455393 GAGTGAGAGCATGCGGTGTTTGG + Intronic
1050624030 9:7484786-7484808 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1050805779 9:9676359-9676381 GAGGGAGAACATGCGGTGTTTGG + Intronic
1050887917 9:10788942-10788964 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1050922582 9:11223821-11223843 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1050976149 9:11941372-11941394 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1051184936 9:14450202-14450224 GAGTGACAACATGCGGTGTTTGG + Intergenic
1051220774 9:14846267-14846289 GAGTGAGAGCATGTGGTGTTTGG - Intronic
1051439710 9:17071889-17071911 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1051830426 9:21269795-21269817 GAGTGACAACATGTGGTGTTTGG + Intergenic
1052153431 9:25150262-25150284 GAGGGAGAACATGTGGTGTTTGG - Intergenic
1052219472 9:26001884-26001906 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1052326246 9:27219395-27219417 GAGTGACAACATGTGGTGTTTGG - Intronic
1052655531 9:31354020-31354042 GAGTGACAACATGCGGTGTTTGG - Intergenic
1053467739 9:38322708-38322730 GAGTGAAAACATGAGGTGTTTGG + Intergenic
1053635163 9:39990877-39990899 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1053719756 9:40933673-40933695 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1053770769 9:41473434-41473456 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1054208724 9:62259821-62259843 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1054549500 9:66385258-66385280 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1054826250 9:69576614-69576636 GAGTGAGAACATGAGGTGTTTGG - Intronic
1054871063 9:70047435-70047457 GAGTGAGAACATGAGGTGTTTGG + Intronic
1055032526 9:71784989-71785011 GAGTGAGAGCATGAGGTGTTTGG - Intronic
1055359933 9:75478712-75478734 GAGGAACATCATGAGGTGTCAGG - Intergenic
1055674947 9:78648651-78648673 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1055851926 9:80642251-80642273 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1056190936 9:84183221-84183243 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1056483372 9:87029549-87029571 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1058554624 9:106153779-106153801 GAATGACAACATGAGGTGTTTGG - Intergenic
1059025602 9:110625683-110625705 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1059851153 9:118341746-118341768 GAGTGACAACATGCGGTGTTTGG + Intergenic
1060649893 9:125316412-125316434 GAGGGAGAACATGCGGTGTTTGG + Intronic
1061646914 9:132010790-132010812 GAGTGACAACATGTGGTGTTTGG - Intronic
1203516603 Un_GL000213v1:7347-7369 GAGGTCCAGCCTTAGGTATTTGG - Intergenic
1203446952 Un_GL000219v1:65599-65621 GAGGGAGAACATGCGGTGTTTGG + Intergenic
1185489336 X:508919-508941 GAGTGACAACATGCGGTGTTTGG + Intergenic
1185539866 X:894524-894546 GAGGCAGAGATTGAGGTGTTGGG + Intergenic
1185695433 X:2190807-2190829 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1185716493 X:2346882-2346904 GAGTGAGAACATGAGGTGTTTGG + Intronic
1185926796 X:4156148-4156170 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1186237497 X:7529352-7529374 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1186369546 X:8932397-8932419 GAGTGACAACATGCGGTGTTTGG + Intergenic
1186645854 X:11506473-11506495 GAGTGACAACATGTGGTGTTTGG + Intronic
1186929672 X:14374983-14375005 GAGTTAGAACATGTGGTGTTTGG - Intergenic
1187638702 X:21262752-21262774 GAGTGACAACATGTGGTGTTTGG + Intergenic
1187650996 X:21406074-21406096 GCGGCACAGCAGGAGGTGTGTGG + Intronic
1187760540 X:22579266-22579288 GAGTGACAACATGCGGTGTTTGG + Intergenic
1187776767 X:22769077-22769099 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1187804537 X:23104535-23104557 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1187835002 X:23423531-23423553 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1188053975 X:25520677-25520699 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1188423266 X:30014804-30014826 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1188739052 X:33755009-33755031 GAGCGACAACATGTGGTGTTTGG - Intergenic
1188826551 X:34842200-34842222 GAGTGACAACATGTGGTGTTTGG - Intergenic
1189138630 X:38577572-38577594 GAGTGAGAGCATGCGGTGTTTGG - Intronic
1189706524 X:43764330-43764352 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1189765060 X:44363015-44363037 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1190358656 X:49628532-49628554 GAGTGACAACATGCGGTGTTTGG + Intergenic
1190665662 X:52694115-52694137 GAGTGACAACATGTGGTGTTTGG - Intronic
1190673756 X:52764295-52764317 GAGTGACAACATGTGGTGTTTGG + Intronic
1190684638 X:52860771-52860793 GAGTGACAACATGTGGTGTTTGG - Intergenic
1190921197 X:54854163-54854185 GAGGGAAAACATGTGGTGTTTGG + Intergenic
1191032266 X:55987433-55987455 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1191215756 X:57930907-57930929 GGGTTACAGCAAGAGCTGTTAGG - Intergenic
1191687628 X:63908698-63908720 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1191726655 X:64288776-64288798 GAGTGACAACATGCGGTGTTTGG - Intronic
1191756473 X:64598131-64598153 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1191771948 X:64770263-64770285 GAGTGACAACATGCGGTGTTCGG + Intergenic
1191908438 X:66121475-66121497 GAGTGACAACATGTGGTGTTTGG + Intergenic
1191926321 X:66314612-66314634 GAGTGACAACATGAGGTGTTTGG + Intergenic
1191963007 X:66724487-66724509 GAGGGAGAACATGTGGTGTTTGG - Intergenic
1191963569 X:66730011-66730033 GAGGGAGAACATGTGGTGTTTGG + Intergenic
1192026856 X:67462361-67462383 GAGAGAGAACATGAGGTGTTTGG - Intergenic
1192071781 X:67948435-67948457 GAGTGACAACATGCGGTGTTTGG - Intergenic
1192073629 X:67967034-67967056 GAGTGACAACATGCGGTGTTTGG - Intergenic
1192302781 X:69923372-69923394 GAGTGAGAACATGAGGTGTTTGG + Intronic
1192620438 X:72674039-72674061 GAGTGAGAGCATGTGGTGTTTGG + Intronic
1192716945 X:73653131-73653153 GAGTGAGAGCATGAGGTGCTTGG - Intronic
1192760849 X:74094848-74094870 GAGTGACAACATGCGGTGTTTGG + Intergenic
1192983105 X:76367814-76367836 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1193019414 X:76775018-76775040 GAGTGACAACATGAGGTGTTTGG + Intergenic
1193336472 X:80295977-80295999 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1193339144 X:80325334-80325356 GAGGGACAACATGTGGTGTTTGG - Intergenic
1193340791 X:80346911-80346933 GAGTGAGAACATGAGGTGTTTGG + Intronic
1193398604 X:81014710-81014732 GAGGAACAGCATGTGGTGTTTGG - Intergenic
1193438495 X:81510017-81510039 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1193476687 X:81974680-81974702 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1193523925 X:82565749-82565771 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1193524794 X:82575991-82576013 GAGTGACAACATGCGGTGTTTGG + Intergenic
1193710228 X:84870590-84870612 GAGGGAGAACATGTGGTGTTTGG - Intergenic
1193738628 X:85190875-85190897 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1194102060 X:89717838-89717860 GAGTTAGAACATGCGGTGTTTGG - Intergenic
1194222819 X:91216602-91216624 GAGTCAGAACATGAGGTGTTTGG + Intergenic
1194362551 X:92971180-92971202 AAGTTAGAACATGAGGTGTTTGG + Intergenic
1194376157 X:93136424-93136446 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1194490131 X:94535558-94535580 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1194608729 X:96013938-96013960 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1194634055 X:96322183-96322205 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1194811794 X:98396583-98396605 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1194953764 X:100155783-100155805 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1195162508 X:102184473-102184495 GAGTGACAACATGCGGTGTTTGG - Intergenic
1195249478 X:103029218-103029240 GAGCTAGAACATGCGGTGTTTGG - Intergenic
1195274168 X:103263884-103263906 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1195400584 X:104457431-104457453 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1195450737 X:105009507-105009529 GAGTGACAACATGTGGTGTTTGG - Intronic
1195480761 X:105342067-105342089 GAGTTAGAACATGTGGTGTTTGG - Intronic
1195549725 X:106153924-106153946 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1195843673 X:109202935-109202957 GAGGGACAACATGCAGTGTTTGG + Intergenic
1195926522 X:110031138-110031160 GAGTGAGAACATGAGGTGTTCGG + Intronic
1196244060 X:113378184-113378206 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1196303974 X:114079085-114079107 GAGTGACAGCATGCAGTGTTTGG + Intergenic
1196750370 X:119111513-119111535 GAGTGACAACATGCGGTGTTTGG - Intronic
1196897317 X:120350155-120350177 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1197053108 X:122084617-122084639 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1197073995 X:122333947-122333969 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1197589621 X:128392415-128392437 GAGTGAGAGCATGCGGTGTTTGG - Intergenic
1197906805 X:131434160-131434182 GAGGGAGAACATGTGGTGTTTGG - Intergenic
1198347793 X:135776080-135776102 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198349698 X:135793342-135793364 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198351601 X:135810617-135810639 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198353512 X:135827880-135827902 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198355417 X:135845135-135845157 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198357327 X:135862420-135862442 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198359241 X:135879700-135879722 GAGGGAGAACATGCGGTGTTTGG - Intergenic
1198875363 X:141219122-141219144 GAGTGAGAGCATGCGGTGTTTGG + Intergenic
1198945602 X:142009788-142009810 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1199013920 X:142790507-142790529 GAGTGACAACATGCGGTGTTTGG + Intergenic
1199067755 X:143440431-143440453 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1199219851 X:145305594-145305616 GAGCCACAGCAAGAGCTGTTGGG + Intergenic
1199797553 X:151215101-151215123 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1199922210 X:152419049-152419071 GAGTGAGAGCATGCGGTGTTTGG - Intronic
1200075358 X:153548001-153548023 TAGGGACAGCAGGAGGTGGTGGG + Intronic
1200382337 X:155851881-155851903 GAGTTACAGCATGTGGTGTTTGG + Intergenic
1200454736 Y:3376086-3376108 GAGTTAGAACATGCGGTGTTTGG - Intergenic
1200559298 Y:4680058-4680080 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1200670804 Y:6087400-6087422 AAGTTAGAACATGAGGTGTTTGG + Intergenic
1200878660 Y:8187995-8188017 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1200879629 Y:8199334-8199356 GAGTGACAACATGCGGTGTTTGG - Intergenic
1201348359 Y:13010147-13010169 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1201350206 Y:13031626-13031648 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1201409616 Y:13686319-13686341 GAGTAAGAGCATGCGGTGTTTGG - Intergenic
1201460014 Y:14212127-14212149 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1201621173 Y:15960115-15960137 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1201635171 Y:16114927-16114949 GAGAAACAATATGAGGTGTTTGG + Intergenic
1201684809 Y:16689118-16689140 GAGTGAGAGCATGTGGTGTTTGG - Intergenic
1201896003 Y:18993285-18993307 GAGTGAGAACATGAGGTGTTTGG - Intergenic
1201970822 Y:19792629-19792651 GAGTGAGAGCATGTGGTGTTTGG + Intergenic
1202020277 Y:20457514-20457536 GAGTGAGAACATGAGGTGTTTGG + Intergenic
1202171284 Y:22046833-22046855 GAGTGACAACATGAGGTGTTTGG - Intergenic
1202220078 Y:22539539-22539561 GAGTGACAACATGAGGTGTTTGG + Intergenic
1202323036 Y:23656123-23656145 GAGTGACAACATGAGGTGTTTGG - Intergenic
1202547736 Y:26013933-26013955 GAGTGACAACATGAGGTGTTTGG + Intergenic
1202602432 Y:26607654-26607676 GAGTGAGAACATGAGGTGTTTGG - Intergenic