ID: 1000481348

View in Genome Browser
Species Human (GRCh38)
Location 5:161779181-161779203
Sequence GAGGTGTATTTTCTGTTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000481348_1000481349 -8 Left 1000481348 5:161779181-161779203 CCTAATAACAGAAAATACACCTC No data
Right 1000481349 5:161779196-161779218 TACACCTCAAGAAGAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000481348 Original CRISPR GAGGTGTATTTTCTGTTATT AGG (reversed) Intergenic
No off target data available for this crispr