ID: 1000485284

View in Genome Browser
Species Human (GRCh38)
Location 5:161834123-161834145
Sequence TGTAATCACTAGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000485284_1000485290 16 Left 1000485284 5:161834123-161834145 CCCACCCCATCCTAGTGATTACA No data
Right 1000485290 5:161834162-161834184 AAGTGCTGCCAGTGTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000485284 Original CRISPR TGTAATCACTAGGATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr