ID: 1000487169

View in Genome Browser
Species Human (GRCh38)
Location 5:161861583-161861605
Sequence TCAGCTACTAAGTCTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000487169_1000487172 16 Left 1000487169 5:161861583-161861605 CCATATCTAGACTTAGTAGCTGA 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1000487172 5:161861622-161861644 GTAGCTCTACATATCATCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1000487169_1000487173 17 Left 1000487169 5:161861583-161861605 CCATATCTAGACTTAGTAGCTGA 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1000487173 5:161861623-161861645 TAGCTCTACATATCATCTAGGGG 0: 1
1: 0
2: 0
3: 1
4: 71
1000487169_1000487171 15 Left 1000487169 5:161861583-161861605 CCATATCTAGACTTAGTAGCTGA 0: 1
1: 0
2: 1
3: 5
4: 84
Right 1000487171 5:161861621-161861643 AGTAGCTCTACATATCATCTAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000487169 Original CRISPR TCAGCTACTAAGTCTAGATA TGG (reversed) Intronic
905614398 1:39384848-39384870 TCAGTTACTAAGGCCAGACACGG - Intronic
908607919 1:65820701-65820723 TCATCTACAAAGTAGAGATATGG + Intronic
919342486 1:196330475-196330497 TCTGCCACTAATTCTAGCTAGGG - Intronic
1063219146 10:3950319-3950341 TGAGCTATTAAATCTAGATAGGG + Intergenic
1064533991 10:16339676-16339698 TCAGATACTATGTCTTGATTTGG - Intergenic
1067352463 10:45488702-45488724 TCAGCTGCTCAGTCTAGAGTAGG - Intronic
1070779274 10:79128061-79128083 TCAGCTTCTGAGTCTAAAGAGGG + Intronic
1070998600 10:80809023-80809045 TCATCAACTAAGTGAAGATAGGG - Intergenic
1071931184 10:90472253-90472275 TCAGCTACTAAGCTAAGAAAAGG - Intergenic
1074283338 10:112074124-112074146 GCAGATACTGAGTCTAGATTTGG - Intergenic
1076101308 10:127781227-127781249 ACAGCAACTAAGTAAAGATATGG + Intergenic
1076199572 10:128547400-128547422 TCTGCTATTAAGTCTGGAGAGGG - Intergenic
1077176384 11:1193058-1193080 TCAGCTGCAAAGTCTTGAGAAGG + Intronic
1083864971 11:65448768-65448790 TCAGCTGTTCAGGCTAGATAGGG - Intergenic
1083898144 11:65630588-65630610 TCACCTACTATGTCAAGGTACGG + Exonic
1085934313 11:81124270-81124292 TCAGCTGCTAAGCCGAGATCTGG - Intergenic
1086133197 11:83421565-83421587 TCAGCCACTAAGCCAAGATCTGG - Intergenic
1086536171 11:87849371-87849393 TCAGCTGCCAATTCTATATATGG - Intergenic
1088711066 11:112509316-112509338 TAAGCTACTAAGTTTTGCTATGG - Intergenic
1091239901 11:134045427-134045449 TCAGCTTCTAAGAGTAGAGAAGG - Intergenic
1091953084 12:4611560-4611582 TCGCCTACAAAGTCTAGACACGG - Intronic
1094157832 12:27356074-27356096 TCAGCTGCTAAGCCTGGACAGGG - Intronic
1094789952 12:33901263-33901285 TAAGGGACTAAGTATAGATAAGG - Intergenic
1101131163 12:101692655-101692677 TGAGCTACTATGTTAAGATAAGG + Intergenic
1104237055 12:126949137-126949159 CTAGCTACTAAGACTGGATAAGG + Intergenic
1105898357 13:24737016-24737038 TGACCTACGAAGTTTAGATATGG - Intergenic
1107849877 13:44560371-44560393 TTAGGTACTAAGTCTGCATAAGG - Intronic
1111679060 13:91422116-91422138 TCAGCTTCTAGGCCTAGAAAGGG - Intronic
1113487776 13:110667224-110667246 TCAGCTAATAGGTCAAGAAATGG - Intronic
1115621102 14:35141549-35141571 TGAGCTACTATGCCTAGACATGG + Intronic
1116736077 14:48693711-48693733 TCAGCTACAGAGACTAGAAAAGG - Intergenic
1121676277 14:95755605-95755627 CCTGCTACTAAGTCTTGCTAGGG + Intergenic
1122248548 14:100422050-100422072 TAAGCTACTAAGTTTAGAGGTGG - Intronic
1133765689 16:8836283-8836305 TCAGCTGCTAAGCCGAGATCTGG + Intronic
1133827190 16:9288682-9288704 TCAGCCACTAACTTTTGATATGG - Intergenic
1143142248 17:4747438-4747460 TCAGTCACTGAGTATAGATAGGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1157346025 18:46834065-46834087 TCAGATACTAGGTCTAAAAATGG - Intronic
1164258807 19:23551711-23551733 TCAGCCACTAAGCCAAGATCTGG - Intronic
1167830171 19:52012886-52012908 TCAGCTACTCAGTCCAGAGTAGG + Intronic
925433811 2:3819166-3819188 TCAGCTGCTAAGCCAAGATCTGG + Intronic
927698891 2:25255117-25255139 TAAGCGACTCAGTCTAGAAAAGG - Intronic
933298663 2:80518855-80518877 TCAGATACTAGGTTTAGATTTGG - Intronic
942464228 2:176190199-176190221 TGAGCTCCTAAGTCTAGATAGGG - Exonic
945535164 2:211007883-211007905 TCAGCTATTATGTCTAATTAAGG + Intergenic
1174963805 20:55187812-55187834 TCTGCTCCTGAGTCTAGATAAGG + Intergenic
1177353452 21:19976094-19976116 TGAGTTATTAAGTGTAGATATGG + Intergenic
1178260454 21:31095259-31095281 TCTGATACTAAAACTAGATAAGG - Intergenic
952346126 3:32487554-32487576 TCAGAGACTCAGTCTAGAAAAGG - Intronic
957889455 3:86336899-86336921 TCAGCTAATATGTATAGAAAGGG + Intergenic
961583982 3:127907187-127907209 GTAGGTACTATGTCTAGATATGG - Intergenic
962296117 3:134189138-134189160 TCATATACTTAGTTTAGATATGG - Intronic
963214315 3:142727106-142727128 TCAACTAGTAAGTCCAAATATGG - Intronic
963267760 3:143255863-143255885 TCAGCTACTATCTCTAGAAGGGG - Intergenic
964592591 3:158381811-158381833 TCACCTACAAAGTCTATTTACGG - Intronic
965639996 3:170821221-170821243 TCAGCTGCTAAGCCGAGATCTGG + Intronic
970248681 4:14091633-14091655 TCTGCTACTAAGACAAGCTAAGG - Intergenic
972746760 4:41940984-41941006 TCACCCACTAACTGTAGATAAGG - Intronic
972804568 4:42515306-42515328 GCAGCTACTAAGAATAGATGTGG + Intronic
975578115 4:75883197-75883219 TGTGCTTCTAAATCTAGATATGG - Exonic
987948748 5:24649874-24649896 TCAGCTGCTCAGTCTAGAGTAGG - Intergenic
989164390 5:38420511-38420533 GCAGCTACTATTTCTAGATGGGG - Intronic
989985728 5:50695207-50695229 TCAGCTCCCAAGTGTAGAAATGG + Intronic
990050976 5:51500574-51500596 TCAGCTAATATGTTTAGAAATGG + Intergenic
991469027 5:66947836-66947858 TCAGCTACTGACTCTAAAGAGGG - Intronic
993726793 5:91378325-91378347 GAAGCTACTAAGACTTGATAGGG + Intronic
995485024 5:112631467-112631489 TCACTTACTAGGTCTAGATTGGG - Intergenic
1000195404 5:158952312-158952334 TCAATTGTTAAGTCTAGATAAGG + Intronic
1000487169 5:161861583-161861605 TCAGCTACTAAGTCTAGATATGG - Intronic
1001884577 5:175277785-175277807 TCAGCTACAAAGGTTGGATATGG + Intergenic
1005666209 6:28059081-28059103 TCATCATCTAAGTTTAGATAAGG + Intergenic
1009268602 6:61589444-61589466 TCAGCAACTAAGTTTAAATAAGG + Intergenic
1012277581 6:97292702-97292724 TCAGGTAGTCAGTCTAGATCTGG + Intergenic
1021899651 7:25271356-25271378 TCAGCTTCTAAGATTAAATATGG - Intergenic
1023279459 7:38554822-38554844 TCAGATATAAAGTTTAGATACGG + Intronic
1033625629 7:143107265-143107287 TCAGCCACTAAGCCGAGATCTGG - Intergenic
1038004979 8:23422331-23422353 TCAGCTGCTCAGTCTAGAGCAGG - Intronic
1038172206 8:25145758-25145780 TCAGCTAGTAAGTGGTGATATGG - Intergenic
1041224729 8:55687058-55687080 GAACCTACTGAGTCTAGATAAGG - Intergenic
1045013802 8:97981521-97981543 TCAGCTACTCAGTGTGGCTATGG - Intronic
1047169241 8:122474918-122474940 TCAGCCACTGACTCTAAATATGG + Intergenic
1050149620 9:2606390-2606412 ACAGCTACTCTGTCTAGAAAAGG + Intergenic
1050735111 9:8752881-8752903 TAAGCTACTAAGTTTAGGGATGG + Intronic
1055365578 9:75541126-75541148 TCAGCTGCTTACTCTAAATAGGG - Intergenic
1055409377 9:76012064-76012086 TTAGATACTAAGTCTACATCTGG - Intronic
1055868878 9:80849926-80849948 TCTGCTACTGAGTCTAAAAAAGG + Intergenic
1056883021 9:90415019-90415041 TCAGCTGCTAAGCCAAGATCTGG - Intergenic
1193438051 X:81503722-81503744 TCAGGTACTAAAGCCAGATAAGG + Intergenic
1196712955 X:118782374-118782396 TCAGCTAATAAGTGTAGAAATGG - Intronic
1196992645 X:121346254-121346276 TCAGCTGCTAAGCCGAGATCTGG + Intergenic
1197191714 X:123654859-123654881 TCAGCTACTGTGTCTTTATAGGG - Intronic