ID: 1000503999

View in Genome Browser
Species Human (GRCh38)
Location 5:162091198-162091220
Sequence GAAGCAGCATACATAGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000503997_1000503999 -1 Left 1000503997 5:162091176-162091198 CCCATATTGCATTAAAAGTCTTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1000503999 5:162091198-162091220 GAAGCAGCATACATAGATGTAGG 0: 1
1: 0
2: 1
3: 9
4: 184
1000503996_1000503999 5 Left 1000503996 5:162091170-162091192 CCTCAGCCCATATTGCATTAAAA 0: 1
1: 0
2: 2
3: 14
4: 195
Right 1000503999 5:162091198-162091220 GAAGCAGCATACATAGATGTAGG 0: 1
1: 0
2: 1
3: 9
4: 184
1000503998_1000503999 -2 Left 1000503998 5:162091177-162091199 CCATATTGCATTAAAAGTCTTGA 0: 1
1: 0
2: 1
3: 11
4: 180
Right 1000503999 5:162091198-162091220 GAAGCAGCATACATAGATGTAGG 0: 1
1: 0
2: 1
3: 9
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000503999 Original CRISPR GAAGCAGCATACATAGATGT AGG Intronic
900964694 1:5949819-5949841 GAAGCAGCACACAGTGAAGTAGG + Intronic
903046259 1:20566378-20566400 GAGGCAGCAGACAGAGATGGTGG - Intergenic
904727269 1:32559053-32559075 GAAGCAGCATAAATAACAGTGGG - Intronic
905007605 1:34722499-34722521 GAAATTGCCTACATAGATGTTGG - Intronic
906812225 1:48839616-48839638 GAAGCAGAATACACAGGAGTTGG + Intronic
908634886 1:66152688-66152710 GAACCAGCTCACATAGTTGTGGG + Intronic
909879021 1:80848799-80848821 GAAGCAGCACACAAAAATTTGGG - Intergenic
910189716 1:84583241-84583263 CAAGCTGCAGACATAGATGCCGG + Intergenic
917624228 1:176829717-176829739 GATGGAGCTTACATAGCTGTGGG - Intronic
917709668 1:177671438-177671460 GGAGCAGCAGTCATAGATGGGGG + Intergenic
917737446 1:177933477-177933499 GAAGGAGCATACAAAGGTGGAGG - Exonic
917992546 1:180396824-180396846 GAAGCATCATACACAGCTGCTGG + Intronic
918227451 1:182497168-182497190 GAAGCAGTTCACATTGATGTAGG - Intronic
918850193 1:189678250-189678272 GGAGCAGCTTACACAGCTGTGGG + Intergenic
921681733 1:218041384-218041406 GCAGCAGAATACATAGGAGTTGG + Intergenic
922803897 1:228376032-228376054 GTAGCAGCAGTCAAAGATGTCGG - Exonic
923446200 1:234073524-234073546 GAAGCAGCAGCCATTGCTGTTGG + Intronic
923858459 1:237869243-237869265 GTAGAATCATACATAGATTTGGG - Intergenic
924313347 1:242770215-242770237 GAAGAAGAACACATACATGTAGG + Intergenic
1066256139 10:33680562-33680584 GAAGCAGGATACATATAAATAGG - Intergenic
1067022904 10:42817583-42817605 GAAGCAGGATACACAGAAGCAGG - Intronic
1068619704 10:59167978-59168000 GAAGCAGCATAAAGAGAGGTAGG + Intergenic
1068657957 10:59593734-59593756 CCAGCAGCATGCATTGATGTTGG - Intergenic
1070448650 10:76534867-76534889 GAAACAGAATACCTAGATGCTGG - Intronic
1070548884 10:77475009-77475031 GAAGGAGCACACAGAGGTGTGGG + Intronic
1070856385 10:79610903-79610925 GACGCAGCATTTATAGATGTGGG - Intergenic
1072059542 10:91796596-91796618 GAAGCAGCAAATACTGATGTAGG - Intergenic
1072936934 10:99722455-99722477 GAAGCAGCAGCTATAGATGCAGG + Intronic
1074677988 10:115874218-115874240 AAAGCAGCATCCATAGCTGGAGG + Intronic
1074706942 10:116141539-116141561 GAAACAGCATTCACAGATTTTGG + Intronic
1075811235 10:125226631-125226653 GCAGCAGCAACCAGAGATGTTGG + Intergenic
1077662464 11:4082114-4082136 GAAGCATCATACAGAGATGTTGG + Intronic
1078854702 11:15197587-15197609 GAAGCAGCTAAGATAGATGAAGG - Intronic
1079997154 11:27306191-27306213 GAAGCAGCATGCATAAAGCTGGG - Intergenic
1082230285 11:49756714-49756736 GAAGAAGCATATTAAGATGTAGG - Intergenic
1082819580 11:57535749-57535771 GAAGAAGCATGGATAGAAGTGGG - Intergenic
1087396736 11:97609904-97609926 GAAGAAGGAGGCATAGATGTGGG - Intergenic
1092184581 12:6469645-6469667 GAAGCAACATAAATACATCTAGG + Intronic
1093496171 12:19760827-19760849 GAGGCAGCATCCATATGTGTGGG - Intergenic
1093799334 12:23353057-23353079 GTAGCAGCAGTTATAGATGTGGG + Intergenic
1094789775 12:33898680-33898702 GAGGCAACATACATAAATATTGG - Intergenic
1095475794 12:42586196-42586218 GAATAATCATACATAGATTTAGG + Intronic
1096502390 12:52072469-52072491 GAAGCAGCATAATCAGGTGTGGG - Intronic
1096563399 12:52453667-52453689 GAATCAGAAAACATAGATGTGGG - Intergenic
1096690583 12:53318881-53318903 GAAGCAGCAGCCACAGAAGTAGG + Intronic
1098712712 12:73785745-73785767 GAAGCACCATTCATTGCTGTTGG - Intergenic
1098752739 12:74316548-74316570 GAATCAGGATAAAGAGATGTGGG - Intergenic
1099217800 12:79874934-79874956 GAATCAGCATGCTTAGATCTGGG - Intronic
1100023337 12:90097847-90097869 GAAGGAACATGCATAGATGCTGG - Intergenic
1100764181 12:97845552-97845574 GAAGAAGCATTCATAGCTTTTGG - Intergenic
1101469058 12:104977875-104977897 GAAGCAGCACACAGAGATCCGGG + Intergenic
1101572810 12:105970711-105970733 GTAGCAGCATACAAACATGATGG + Intergenic
1106004272 13:25753910-25753932 GGAAAAGCATACATGGATGTTGG - Intronic
1106353675 13:28958455-28958477 GGAGCAGCCTAAATTGATGTTGG + Intronic
1106493896 13:30256741-30256763 GATACAGCATATTTAGATGTTGG + Intronic
1107873316 13:44766374-44766396 GGAACAGAAAACATAGATGTGGG + Intergenic
1108161278 13:47642433-47642455 GAAGTAGAATAAACAGATGTTGG - Intergenic
1108349752 13:49581135-49581157 GAAGTGGCATAAACAGATGTAGG + Intronic
1108516928 13:51212231-51212253 GAAGCAGTATCCAGAGAGGTGGG + Intergenic
1110866411 13:80400866-80400888 GGAGCAGCAAACGTTGATGTAGG - Intergenic
1113405185 13:110032219-110032241 GAAGAAGCTCACATAGTTGTGGG - Intergenic
1120476789 14:84998570-84998592 GAAGCAGCCTCCACAGATATAGG - Intergenic
1122718403 14:103708517-103708539 GAAGCAGCATCCTTACAGGTAGG - Exonic
1126007043 15:44267725-44267747 TAAGCAGGATATCTAGATGTTGG - Intergenic
1132947706 16:2541159-2541181 GCAGCAGCCTGCAGAGATGTGGG + Intronic
1132966733 16:2660184-2660206 GCAGCAGCCTGCAGAGATGTGGG - Intergenic
1135967204 16:27045998-27046020 GAAGCAGCATACACAGGATTTGG - Intergenic
1136423340 16:30151500-30151522 CGAGCTGCAGACATAGATGTTGG - Intergenic
1141903530 16:87007969-87007991 GTAGCAGCATCCATTGATGATGG - Intergenic
1144107537 17:11999087-11999109 GAAGCAGAGCACATTGATGTTGG - Intergenic
1145839478 17:27982462-27982484 TAAGCACCATAAATACATGTAGG + Intergenic
1148146551 17:45368870-45368892 GAAGCCTCATACATTGCTGTTGG + Intergenic
1149658154 17:58320874-58320896 GAAGGAGCATCCAGAGAGGTAGG - Intronic
1150529906 17:65966438-65966460 GAAGCCTTATACATACATGTTGG - Intronic
1150663286 17:67105227-67105249 GAATCCTCATACATAGCTGTGGG + Intronic
1153310909 18:3676093-3676115 CAAGCTGCAGACATAGATGCCGG + Intronic
1156968377 18:43124401-43124423 GAAGAAACATACAGAGATTTAGG + Intergenic
1157595056 18:48859325-48859347 GCAGCTGCAGACAGAGATGTGGG - Exonic
1158307009 18:56116975-56116997 GAAGCAGCCTAACTAGAAGTGGG - Intergenic
1159037107 18:63287815-63287837 GAAGCAGGATTCAGATATGTGGG + Intronic
1163101333 19:15098885-15098907 GAAGAAAAATACATACATGTGGG + Intergenic
1166501319 19:43343636-43343658 GACACAGCAGAGATAGATGTAGG + Intergenic
926779686 2:16458428-16458450 GAAGGAGAAGACAAAGATGTGGG - Intergenic
927105368 2:19819178-19819200 GGAGGGGCATACATAGATGAAGG + Intergenic
928291046 2:30037649-30037671 GAAGCAGCATAAATAGTCTTTGG + Intergenic
928936029 2:36679043-36679065 GGTGCAGCATACATATAAGTGGG - Intergenic
931631881 2:64309498-64309520 GAAGAAGCATTCATATATTTTGG - Intergenic
932729848 2:74211779-74211801 GGAGCAGCAGTCATTGATGTGGG + Exonic
933002454 2:76942598-76942620 GAACCAGTATTCATAAATGTTGG - Intronic
935363700 2:102268405-102268427 GAAGCTGCAGACATGGATGTGGG - Intergenic
936734139 2:115419751-115419773 CAAGCAGCATACACAGTTTTGGG - Intronic
937744893 2:125400549-125400571 AATGCAGCATTCATAGATTTTGG - Intergenic
937798717 2:126056600-126056622 CAAGCTGCAGACATAGATGCTGG + Intergenic
941609224 2:167640207-167640229 TAGGCAGCATTCATAGAAGTGGG - Intergenic
944864739 2:203849393-203849415 GAAGCAATATCCCTAGATGTGGG - Intergenic
944890750 2:204114982-204115004 GAAGCAGCCAAGATAGATGGAGG - Intergenic
945677306 2:212870948-212870970 GAAGAAGGACAAATAGATGTTGG - Intergenic
945921391 2:215758490-215758512 GAAGCAGAAGAAATAAATGTAGG + Intergenic
947851573 2:233292835-233292857 GAAGCAGGATACATGGAAGAAGG - Intronic
948658386 2:239491205-239491227 GAAGCAGCACACATTTATGGTGG + Intergenic
1169000600 20:2165122-2165144 GAAGCAGCAGACCCAGATGAAGG + Intronic
1170085649 20:12528795-12528817 GAAGCAGGATATTTAGATGTCGG + Intergenic
1170827915 20:19812327-19812349 GAAGCACCATACATAGTTGATGG - Intergenic
1172314927 20:33946354-33946376 GAAGGAGGATAAATGGATGTGGG - Intergenic
1173359113 20:42323898-42323920 GAACCATCATACATTGCTGTTGG + Intronic
1173702851 20:45088299-45088321 GAAGAAGAATGCAGAGATGTGGG + Intergenic
1181390018 22:22573496-22573518 GAAGGAGCAAACTTAGATTTGGG + Intergenic
1185310120 22:50149722-50149744 GAAGCAGCACACACAGTAGTCGG - Intronic
954474582 3:50731884-50731906 GAAGTAGCAAACATAAATATTGG + Intronic
955583714 3:60453471-60453493 GATGCAACATAGATAGATGTGGG + Intronic
960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG + Intergenic
963009651 3:140757237-140757259 GAGACAGCATACATAAATATGGG + Intergenic
966954855 3:184865619-184865641 GAAGCCTCATACATTGATGGTGG + Intronic
969500199 4:7547970-7547992 AAAGCAGAATCCACAGATGTTGG - Intronic
970877410 4:20887431-20887453 GAAGAATCACACATAGCTGTAGG + Intronic
971208851 4:24596872-24596894 GAAGCAGCTTACAAACATTTTGG + Intergenic
973744073 4:53946321-53946343 CAAGCAGCAGACATTGATGCTGG - Intronic
975960074 4:79892031-79892053 GAGGAAGCAAACATATATGTAGG - Intergenic
976672543 4:87669904-87669926 GAAGCAGCATTTAATGATGTGGG + Intergenic
976786477 4:88827015-88827037 GAGGCAGCAGAGATAGATTTGGG - Intronic
977343044 4:95784901-95784923 GAAACAGCATACACATATGTTGG + Intergenic
978456524 4:108898676-108898698 GAAGCAGTAGAGAGAGATGTGGG + Intronic
978679548 4:111362990-111363012 GCAGCAGCAGGCACAGATGTTGG + Intergenic
979523685 4:121696524-121696546 GTCGCAGCATACAAAGTTGTGGG + Intronic
981012571 4:139940613-139940635 GAAGCAGCTAACACAGATTTTGG - Intronic
982561777 4:156936855-156936877 GAAGCAGCAAAAACAGATCTTGG + Intronic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
983631516 4:169854159-169854181 GAGGCAGCACACATAGAATTAGG + Intergenic
985519744 5:368164-368186 GAGGCAGCATCCATACCTGTGGG + Intronic
992524075 5:77589145-77589167 GAAGCAGCAAATATTGATTTGGG + Intronic
992628648 5:78658957-78658979 GAAGCAGCAAACATGGATAAGGG + Intronic
994748191 5:103705144-103705166 TAAGCATCATAACTAGATGTAGG - Intergenic
996205516 5:120730448-120730470 TAAGCTGAATACATAGATTTGGG + Intergenic
996486817 5:124044874-124044896 CATGCAGCATACATGGAAGTGGG + Intergenic
997816251 5:137021227-137021249 GCAGCAGCATAGATAAATTTTGG + Intronic
998584371 5:143411418-143411440 GAAGCAACAAAAATGGATGTTGG - Intronic
1000503999 5:162091198-162091220 GAAGCAGCATACATAGATGTAGG + Intronic
1001884868 5:175280346-175280368 GAAGCAGAATGCACAGAAGTTGG + Intergenic
1002650366 5:180687276-180687298 GAAGGAGCATATATAGATTCAGG - Intergenic
1004342613 6:14820696-14820718 AGAGCAGCATACACAGATATTGG - Intergenic
1004885366 6:20046251-20046273 AAATCTGCATACATAGATCTAGG - Intergenic
1005408756 6:25520266-25520288 GAAGCATCATACATAGGAATTGG - Exonic
1005530463 6:26699595-26699617 GAAGGAACAGGCATAGATGTAGG - Intergenic
1005540333 6:26802051-26802073 GAAGGAACAGGCATAGATGTAGG + Intergenic
1006719265 6:36139517-36139539 GATGCAGAATTCAAAGATGTCGG + Exonic
1007142064 6:39586003-39586025 GAAGCCTCATACACAGATTTTGG - Intronic
1009011146 6:57844149-57844171 GAAGGAACAGGCATAGATGTAGG + Intergenic
1009863258 6:69363367-69363389 GAAAGAGAATATATAGATGTGGG + Intronic
1013992415 6:116269108-116269130 TAACCAGCATACAAAGGTGTGGG - Intronic
1014585690 6:123194986-123195008 GAATCAGCAGACATAGACATTGG + Intergenic
1014899144 6:126942087-126942109 GAAGCAGCACACACAGTGGTTGG + Intergenic
1015637727 6:135295282-135295304 GAAGCAGAACTCATACATGTTGG + Intronic
1016557950 6:145360899-145360921 CGAGCTGCAGACATAGATGTTGG + Intergenic
1019195120 6:170276749-170276771 GAAACAGCATACTTAGCTTTTGG + Intergenic
1021704973 7:23357998-23358020 GAAGCAGCAATCAAACATGTTGG + Intronic
1022411111 7:30139113-30139135 GGAGCAGCATCCATACATGATGG + Intronic
1022818364 7:33934988-33935010 CAAGCAGCATACATACCTGGTGG + Intronic
1023512016 7:40963148-40963170 TAAGCATAATACATACATGTGGG - Intergenic
1027460083 7:78441006-78441028 GCAGCTGGATACATGGATGTGGG + Intronic
1027747386 7:82094161-82094183 GAAGCACAGTACATAGAAGTCGG + Intronic
1028325432 7:89518438-89518460 GAGACAGCATAAATAGATTTAGG - Intergenic
1029571183 7:101370679-101370701 GAAGCAGCAGGTATAGATGAAGG - Intronic
1031046600 7:116896110-116896132 GAGGAAACATACATATATGTGGG - Intronic
1031111475 7:117615155-117615177 GAAGCTGCATACATAATTATTGG + Intronic
1033007177 7:137578811-137578833 GAAGCTGCATACATAGCTTACGG - Intronic
1035787496 8:2273209-2273231 GGAGCAGGATAGACAGATGTAGG - Intergenic
1035805311 8:2448507-2448529 GGAGCAGGATAGACAGATGTAGG + Intergenic
1036042219 8:5098040-5098062 GAAGCCACATACATTGATGCTGG - Intergenic
1036288966 8:7470398-7470420 CAAACAGCATGCATAGGTGTTGG + Exonic
1036332508 8:7841130-7841152 CAAACAGCATGCATAGGTGTTGG - Exonic
1036719503 8:11160325-11160347 GATGCAGCATATACAGATGATGG + Intronic
1038576370 8:28707240-28707262 GAAGCAGTATACAGGGCTGTAGG + Intronic
1044078850 8:87859059-87859081 CAAGTAGCATGCAAAGATGTGGG + Intergenic
1044318381 8:90775272-90775294 GAAGCAGCATACATTGCTTGTGG - Intronic
1045857483 8:106781034-106781056 GAAGGAGCATCCAGTGATGTAGG - Intergenic
1046525415 8:115376651-115376673 GGAAAAGGATACATAGATGTTGG + Intergenic
1048804128 8:138223560-138223582 GAAGCAGCCTACAAACAAGTGGG + Intronic
1048864153 8:138747055-138747077 GAAGCAGTGTTCATAGATTTAGG + Intronic
1053333955 9:37246793-37246815 GCAGGAGCATCCATAGATTTTGG + Intronic
1058013196 9:100000995-100001017 GAAGCAGCAAAAATAGTTTTAGG - Intronic
1058560126 9:106219314-106219336 TAAGCTGCATACATAGGTGGAGG - Intergenic
1060474351 9:123975767-123975789 GCAGCAGCATTCATTGAAGTTGG - Intergenic
1186366989 X:8906069-8906091 GAAACAGCATTCCTAAATGTAGG + Intergenic
1188119832 X:26290994-26291016 GAAACAGTATACGAAGATGTGGG + Intergenic
1189580826 X:42404445-42404467 CAAGCTGCAGACATAGATGCTGG - Intergenic
1190287041 X:48968481-48968503 GGTGCAGGATACATAGGTGTTGG - Intronic
1190382062 X:49848575-49848597 GAATCAGAATACATTGTTGTGGG + Intergenic
1190974970 X:55389922-55389944 GGAGCAGTATGCATTGATGTTGG - Intergenic
1191600045 X:62993464-62993486 GCAGTAGCAGCCATAGATGTTGG - Intergenic
1191910191 X:66142102-66142124 GAAGAAGCAAACAAAAATGTTGG - Intergenic
1192363683 X:70454573-70454595 GAAGCAGCATCCAAAGATTAGGG + Intronic
1194434073 X:93848797-93848819 TAAGCAGCATACACTGGTGTTGG + Intergenic
1195342202 X:103917228-103917250 GAAGTAGCATACAGAGAAGTGGG - Intergenic
1198129486 X:133679523-133679545 GAACCAACAAACATAGTTGTGGG - Intronic
1199408635 X:147493413-147493435 GGAGCAGAGTACATAGAAGTAGG + Intergenic