ID: 1000504158

View in Genome Browser
Species Human (GRCh38)
Location 5:162093161-162093183
Sequence GCATTTGCCATGATAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000504158 Original CRISPR GCATTTGCCATGATAAAGGG TGG Intronic
900568124 1:3345376-3345398 GCATGTGGCATAATAAAGAGTGG - Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901756038 1:11442201-11442223 GTATTTGCCTTGATATGGGGAGG + Intergenic
904122999 1:28215322-28215344 ACATTTGCAAAAATAAAGGGAGG - Intronic
904236375 1:29120245-29120267 GCATAGGCCACGATAAAGGAAGG + Exonic
905395935 1:37666581-37666603 GCATTTGTGAGGATTAAGGGGGG - Intergenic
905967389 1:42110442-42110464 GTATTTGCCTTGATAAATGTAGG - Intergenic
907473348 1:54689001-54689023 GCATGTGCCAGGCTGAAGGGGGG + Intronic
908249951 1:62257514-62257536 GCATTTGGCAAAATAAAGGACGG + Intronic
916430922 1:164727654-164727676 CCACTTCCCATGACAAAGGGAGG - Intronic
923537341 1:234863319-234863341 GCATTTGCTATGATTGATGGAGG + Intergenic
1064246581 10:13672684-13672706 GCATTTGGCAGGATATAGGGAGG - Intronic
1064465904 10:15581550-15581572 GCAGTTGGCATGAAAAAGGCAGG + Intronic
1066644927 10:37596723-37596745 GTATATGCTTTGATAAAGGGAGG + Intergenic
1067184323 10:44014147-44014169 GTATGTGCCATGATAAAAAGAGG - Intergenic
1068668254 10:59698400-59698422 GGATTTGCCACGTTAAAGTGTGG - Intronic
1069267804 10:66484873-66484895 TCATGTGCTATGATAAAGTGGGG + Intronic
1069936332 10:71919854-71919876 GCATTTACCTGGATAAAGGATGG - Intergenic
1074919915 10:117997645-117997667 CCATTGTCCTTGATAAAGGGAGG - Intergenic
1076039983 10:127238198-127238220 GCATTTGACAAGACAAATGGTGG - Intronic
1076305721 10:129464642-129464664 GAAATTACCATGATGAAGGGAGG + Intergenic
1076429713 10:130393265-130393287 GGTTTTGCCATGATGCAGGGAGG + Intergenic
1076521938 10:131086699-131086721 GCCATGGCCATGACAAAGGGTGG - Intergenic
1077387526 11:2277410-2277432 GCATTTGCCATGTTAGAGCTGGG - Intergenic
1078493296 11:11789551-11789573 GGATTTTCTATGATATAGGGGGG - Intergenic
1088466114 11:110140618-110140640 GGACTTGCCATGATAAAGGAGGG - Intronic
1095049776 12:37545365-37545387 GCATGTGCCATGTGGAAGGGGGG - Intergenic
1096234421 12:49916335-49916357 GAATTTGCCAGGAAGAAGGGAGG - Intergenic
1101661196 12:106766835-106766857 GCATTTATGATGAGAAAGGGAGG - Intronic
1103972151 12:124678987-124679009 GCATTTGTCATTATTAAGAGAGG - Intergenic
1107404363 13:40098805-40098827 GCATGTGCCATGACAAAAGATGG - Intergenic
1112204705 13:97313213-97313235 GCCTTTGTCAGGATAAAGGCAGG + Intronic
1114561518 14:23595072-23595094 TCATTTCCCATGATCAAGCGGGG - Intergenic
1115109207 14:29801251-29801273 GCATTAGCCTTGATAATGTGGGG - Intronic
1115464339 14:33698351-33698373 GCTTTTGCCATGAAACTGGGTGG + Intronic
1116267929 14:42719935-42719957 TCATTTTCTATGATAAAAGGTGG + Intergenic
1116430954 14:44844734-44844756 GCATTTTCAATGATAAAGAAAGG + Intergenic
1117999296 14:61508138-61508160 TCAATTGCCATGTTAAAGGCTGG - Intronic
1125377531 15:39046846-39046868 GCATATGCCATTTTAAAGCGAGG + Intergenic
1125469823 15:39991726-39991748 GCATTAGCCATGAGCGAGGGTGG + Intronic
1125708653 15:41765175-41765197 GCATTTGCCTTGGTAAGAGGTGG + Intronic
1128241461 15:66104129-66104151 ACATTTGCCTTCACAAAGGGAGG - Intronic
1130602872 15:85289287-85289309 GCGTTTGCCATGAGAAGGAGGGG - Intergenic
1130675517 15:85948622-85948644 GCAATAGCCATGATCTAGGGTGG + Intergenic
1133524813 16:6594373-6594395 GCATGTGCGATTATAAATGGTGG + Intronic
1133617340 16:7490192-7490214 GCATCTGCCTTGAACAAGGGGGG - Intronic
1136148024 16:28327303-28327325 GAATGTGCCATGATCAGGGGAGG - Intergenic
1140161354 16:72498015-72498037 GCACCTGCCATGAGAGAGGGTGG + Intergenic
1141213831 16:82005683-82005705 GCACTTGCCATTATAAAGGCAGG - Intronic
1146506011 17:33405986-33406008 GCATTTTCCATGGGAAAGGCAGG - Intronic
1147047146 17:37761622-37761644 GCAATTGCCTAGATAAAGAGAGG - Intergenic
1151348299 17:73516585-73516607 GCATCTGCTAGGATACAGGGAGG - Intronic
1156016196 18:32549818-32549840 GAATTTGGCATAAGAAAGGGTGG + Intergenic
1156609497 18:38709595-38709617 GCATTTGACAACATGAAGGGAGG + Intergenic
1156794270 18:41023043-41023065 GCTTTTTCCAGGATATAGGGAGG - Intergenic
1157404109 18:47409272-47409294 TCATTTGCAAAGATAAAGGCAGG + Intergenic
1160683137 19:421606-421628 GCATAAGTCATGATAAATGGGGG + Intronic
925756768 2:7140465-7140487 GCAGTTCACGTGATAAAGGGAGG - Intergenic
926363698 2:12113846-12113868 CCATTTGCCCAGATAAATGGAGG - Intergenic
929796922 2:45066894-45066916 GCACTTGGCATGATAAAGCATGG + Intergenic
932300971 2:70666823-70666845 GCATCTGCCATGATTCAGAGAGG + Intronic
940356144 2:152744530-152744552 GCATATGCCAAGGTAAAGAGTGG + Intronic
940851815 2:158694375-158694397 GACTTTGCCAAAATAAAGGGAGG - Intergenic
945374973 2:209068820-209068842 GAATATGCCATGATCAAGGCAGG - Intergenic
945617658 2:212093082-212093104 GCATTTTCCATGTAAAAGAGAGG - Intronic
946192655 2:218015724-218015746 GCAGCTGACATGATAAACGGGGG + Intergenic
1169586389 20:7090652-7090674 GCAATTTCCATGCCAAAGGGTGG + Intergenic
1170093742 20:12621701-12621723 CCAGTTGCAATGATAACGGGAGG - Intergenic
1178021270 21:28411244-28411266 GCATTTGCCTTAAAATAGGGAGG - Intergenic
1178337164 21:31753617-31753639 ACATTTGCCTTGATTAATGGTGG + Intergenic
1179630626 21:42676064-42676086 GCATATCACATGATGAAGGGAGG - Intronic
1179725856 21:43340881-43340903 GCCTTTGCGAGGATAAAGCGTGG + Intergenic
1180243014 21:46524412-46524434 GCATTTACCAGGGTAAAGGATGG - Intronic
1184004627 22:41699250-41699272 GCATTTGCCTTGAAAAAGGAAGG - Intergenic
1184519113 22:44982002-44982024 GCATTTGCCAAGGCAACGGGAGG - Intronic
952927284 3:38329322-38329344 GCATTTGAGATGGTAAAGTGTGG - Intergenic
961066200 3:123879413-123879435 GCATTTGCCAGGAGAGAGGAAGG - Intronic
964527362 3:157629808-157629830 ATATTTGCCATGCTAAATGGTGG - Intronic
967583128 3:191183590-191183612 GCATCAGCCATGATAAATGTAGG + Intergenic
981585260 4:146294333-146294355 GCATTTGGCATGATTAAGGATGG - Intronic
982433436 4:155351305-155351327 GAATTTGCCCTGATACATGGTGG - Intronic
983301223 4:165928474-165928496 GGATTTGCCAGGAGAAAAGGAGG + Intronic
984038572 4:174700472-174700494 TAATTTGCCATCATATAGGGAGG - Intronic
991365141 5:65860263-65860285 GGATTTTCCATGAGAAAGAGGGG - Intronic
991426727 5:66499629-66499651 GCCTTTCTCATGATAAAGGGTGG + Intergenic
996188748 5:120512921-120512943 GAATATGCTATAATAAAGGGAGG + Intronic
998038463 5:138935986-138936008 GCATTTGGCAAGAGGAAGGGGGG - Intergenic
1000504158 5:162093161-162093183 GCATTTGCCATGATAAAGGGTGG + Intronic
1014451467 6:121586668-121586690 TCATTTGACATGAGAAAGTGTGG + Intergenic
1018200459 6:161389978-161390000 CCTTTTGCCATGCTAAAGTGGGG - Intronic
1023523038 7:41068008-41068030 GCAGTTGCCATGAAAAAGCCAGG - Intergenic
1024391312 7:48815837-48815859 GCATTTACCATGAATAAAGGAGG - Intergenic
1024480857 7:49861060-49861082 GCAGACACCATGATAAAGGGCGG - Intronic
1026394148 7:69934795-69934817 GCATTTGTCTTGCTAAGGGGTGG - Intronic
1026544451 7:71309694-71309716 GGAATTCCCATAATAAAGGGTGG + Intronic
1030544188 7:110872017-110872039 GCCTTTGCCATGAGAGAGGGAGG - Intronic
1031110744 7:117605627-117605649 GCATTTGAGTTGAGAAAGGGAGG + Intronic
1033421983 7:141211696-141211718 GAATTTGCAAACATAAAGGGTGG + Intronic
1036179359 8:6569729-6569751 GTATTTGCCATGTTAAAGAGGGG - Intronic
1045517602 8:102874038-102874060 CCATTTGTCATCATAAGGGGTGG + Intronic
1046299148 8:112263222-112263244 GCATTTGTCATGATAATGATTGG - Intronic
1051010799 9:12411263-12411285 GCATTTGACAAGATAAAGTATGG - Intergenic
1053552583 9:39099819-39099841 GCATTTGATATTATAAAGAGAGG - Intronic
1053816700 9:41919978-41920000 GCATTTGATATTATAAAGAGAGG - Intronic
1054106962 9:61063660-61063682 GCATTTGATATTATAAAGAGAGG - Intergenic
1054613895 9:67267465-67267487 GCATTTGATATTATAAAGAGAGG + Intergenic
1057493057 9:95537664-95537686 ACATTTGCCTTGATAAAGCAAGG - Intergenic
1058415638 9:104785716-104785738 ACTTGTGCCATGAAAAAGGGCGG + Intronic
1058602738 9:106688275-106688297 GCATTTTCCATGCTAAAATGAGG + Intergenic
1061423362 9:130484098-130484120 GCAGTTGCCATGGTGATGGGAGG - Intronic
1190108751 X:47576230-47576252 GTATCTGCCAAGACAAAGGGTGG + Exonic
1196824743 X:119732204-119732226 GGATTTGACAGCATAAAGGGAGG + Intergenic