ID: 1000514249

View in Genome Browser
Species Human (GRCh38)
Location 5:162220268-162220290
Sequence CTTGTCTTCCTCATCTATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000514249_1000514255 24 Left 1000514249 5:162220268-162220290 CCCCTATAGATGAGGAAGACAAG No data
Right 1000514255 5:162220315-162220337 GATATCAAACATGAATTTCCAGG No data
1000514249_1000514252 -8 Left 1000514249 5:162220268-162220290 CCCCTATAGATGAGGAAGACAAG No data
Right 1000514252 5:162220283-162220305 AAGACAAGAAAGACTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000514249 Original CRISPR CTTGTCTTCCTCATCTATAG GGG (reversed) Intergenic
No off target data available for this crispr