ID: 1000516496

View in Genome Browser
Species Human (GRCh38)
Location 5:162241502-162241524
Sequence CATCGGATGGAGGGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000516485_1000516496 5 Left 1000516485 5:162241474-162241496 CCCCCTAGGGTCTCAGGGTTTTT No data
Right 1000516496 5:162241502-162241524 CATCGGATGGAGGGCGTGGAGGG No data
1000516488_1000516496 2 Left 1000516488 5:162241477-162241499 CCTAGGGTCTCAGGGTTTTTATA No data
Right 1000516496 5:162241502-162241524 CATCGGATGGAGGGCGTGGAGGG No data
1000516486_1000516496 4 Left 1000516486 5:162241475-162241497 CCCCTAGGGTCTCAGGGTTTTTA 0: 21
1: 45
2: 46
3: 77
4: 219
Right 1000516496 5:162241502-162241524 CATCGGATGGAGGGCGTGGAGGG No data
1000516487_1000516496 3 Left 1000516487 5:162241476-162241498 CCCTAGGGTCTCAGGGTTTTTAT No data
Right 1000516496 5:162241502-162241524 CATCGGATGGAGGGCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000516496 Original CRISPR CATCGGATGGAGGGCGTGGA GGG Intergenic
No off target data available for this crispr