ID: 1000528604

View in Genome Browser
Species Human (GRCh38)
Location 5:162389633-162389655
Sequence GTTGACCTGATTCCCCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000528600_1000528604 8 Left 1000528600 5:162389602-162389624 CCCCAGATGTATGCAATGAATAG No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528596_1000528604 14 Left 1000528596 5:162389596-162389618 CCCCACCCCCAGATGTATGCAAT No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528595_1000528604 15 Left 1000528595 5:162389595-162389617 CCCCCACCCCCAGATGTATGCAA No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528602_1000528604 6 Left 1000528602 5:162389604-162389626 CCAGATGTATGCAATGAATAGCT No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528594_1000528604 24 Left 1000528594 5:162389586-162389608 CCATTTTCTCCCCCACCCCCAGA No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528601_1000528604 7 Left 1000528601 5:162389603-162389625 CCCAGATGTATGCAATGAATAGC No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528599_1000528604 9 Left 1000528599 5:162389601-162389623 CCCCCAGATGTATGCAATGAATA No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528598_1000528604 12 Left 1000528598 5:162389598-162389620 CCACCCCCAGATGTATGCAATGA No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data
1000528597_1000528604 13 Left 1000528597 5:162389597-162389619 CCCACCCCCAGATGTATGCAATG No data
Right 1000528604 5:162389633-162389655 GTTGACCTGATTCCCCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000528604 Original CRISPR GTTGACCTGATTCCCCAGAA GGG Intergenic
No off target data available for this crispr