ID: 1000529012

View in Genome Browser
Species Human (GRCh38)
Location 5:162394946-162394968
Sequence GATTTCAACAGAAACCTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000529011_1000529012 -3 Left 1000529011 5:162394926-162394948 CCTACATAAAATTATCAGGAGAT No data
Right 1000529012 5:162394946-162394968 GATTTCAACAGAAACCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000529012 Original CRISPR GATTTCAACAGAAACCTAGC AGG Intergenic
No off target data available for this crispr