ID: 1000531761

View in Genome Browser
Species Human (GRCh38)
Location 5:162430611-162430633
Sequence TGCAATTGCTGTTTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000531753_1000531761 6 Left 1000531753 5:162430582-162430604 CCTGGACTCCCACATATAACTGA No data
Right 1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG No data
1000531751_1000531761 29 Left 1000531751 5:162430559-162430581 CCATGCTGAGAGGAACTGAGGCT No data
Right 1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG No data
1000531754_1000531761 -2 Left 1000531754 5:162430590-162430612 CCCACATATAACTGACCAGCATG No data
Right 1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG No data
1000531755_1000531761 -3 Left 1000531755 5:162430591-162430613 CCACATATAACTGACCAGCATGC No data
Right 1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG No data
1000531750_1000531761 30 Left 1000531750 5:162430558-162430580 CCCATGCTGAGAGGAACTGAGGC No data
Right 1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000531761 Original CRISPR TGCAATTGCTGTTTTGGGGA GGG Intergenic
No off target data available for this crispr