ID: 1000533535

View in Genome Browser
Species Human (GRCh38)
Location 5:162453231-162453253
Sequence CTGGAGATCTGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000533535_1000533546 16 Left 1000533535 5:162453231-162453253 CCCTCTGCCCTCCAGATCTCCAG No data
Right 1000533546 5:162453270-162453292 CAGATTTGGTCTTTGACACTGGG No data
1000533535_1000533545 15 Left 1000533535 5:162453231-162453253 CCCTCTGCCCTCCAGATCTCCAG No data
Right 1000533545 5:162453269-162453291 CCAGATTTGGTCTTTGACACTGG No data
1000533535_1000533547 27 Left 1000533535 5:162453231-162453253 CCCTCTGCCCTCCAGATCTCCAG No data
Right 1000533547 5:162453281-162453303 TTTGACACTGGGTGTGAAGTTGG No data
1000533535_1000533541 2 Left 1000533535 5:162453231-162453253 CCCTCTGCCCTCCAGATCTCCAG No data
Right 1000533541 5:162453256-162453278 CAGTCACCCTATGCCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000533535 Original CRISPR CTGGAGATCTGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr